G2036435



Basic Information


Item Value
gene id G2036435
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 48803113 ~ 48803496 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2329594
gctctcactttaaacacaatcaaccctggaatgagagaaagagcctcatacagctctcactttaaacacaatcaaccctggaatgagagaaagagcctcatacagctctcactttaaacacaatcaaccctggaacgagagaaagagcctcatacagctctcactttaaacacaatcaaccctggaacgagagaaagagcctcatacagctctcactttaaacacaatcaaccctggaacgagagaaagagcctcatacagctctcactttaaacacaatcaaccctggaatgagagaaagagcctcatacagctctcactttaaacacaatcaaccctggaatgagagaaagagcctcatacagctctcactttaaacacaat

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2329594 True 384 lncRNA 0.43 1 48803113 48803496
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110487445 tle3 coding downstream 184221 48562877 ~ 48618892 (-)
LOC110518410 LOC106562701 coding downstream 686606 48110914 ~ 48116507 (-)
LOC110520392 LOC106562707 coding downstream 809970 47896701 ~ 47993143 (-)
LOC110511870 NA coding downstream 912928 47888685 ~ 47890185 (-)
LOC110526754 LOC106562769 coding downstream 948127 47846318 ~ 47854986 (-)
LOC118944539 LOC106587861 coding upstream 8300 48811796 ~ 48893711 (-)
mo4l1 mo4l1 coding upstream 108142 48911638 ~ 48925033 (-)
LOC110526784 LOC106562667 coding upstream 122969 48926465 ~ 48928519 (-)
LOC110527003 LOC105013624 coding upstream 133546 48937042 ~ 49046675 (-)
LOC110514539 LOC106587757 coding upstream 247548 49051044 ~ 49060342 (-)
G2036434 NA non-coding downstream 335 48802224 ~ 48802778 (-)
G2036419 NA non-coding downstream 20401 48782003 ~ 48782712 (-)
G2036417 NA non-coding downstream 22463 48780348 ~ 48780650 (-)
G2036407 NA non-coding downstream 34564 48768343 ~ 48768549 (-)
G2036367 NA non-coding downstream 106890 48695619 ~ 48696223 (-)
G2036652 NA non-coding upstream 27067 48830563 ~ 48831390 (-)
G2036666 NA non-coding upstream 78873 48882369 ~ 48883820 (-)
G2036667 NA non-coding upstream 80426 48883922 ~ 48884287 (-)
G2036671 NA non-coding upstream 92727 48896223 ~ 48896559 (-)
G2036680 NA non-coding upstream 112067 48915563 ~ 48916002 (-)
G2036102 LOC106562708 other downstream 575516 48225737 ~ 48227597 (-)
trip4 trip4 other downstream 1223999 47504873 ~ 47579187 (-)
LOC110506956 LOC106562712 other downstream 1684953 47100651 ~ 47118376 (-)
G2034880 NA other downstream 1972492 46830334 ~ 46830621 (-)
smad3 smad3 other upstream 513532 49317028 ~ 49341509 (-)
LOC110513834 chst1 other upstream 813383 49615631 ~ 49620267 (-)
G2037622 LOC106562569 other upstream 1136025 49939521 ~ 49941299 (-)
G2037650 NA other upstream 1176305 49979801 ~ 49980676 (-)
G2037925 NA other upstream 1498493 50301989 ~ 50309277 (-)

Expression


G2036435 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G2036435 Expression in each Bioproject

Bar chart with 12 bars.
G2036435 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network