G2044758 (kmt2a)


Basic Information

Item Value
gene id G2044758
gene name kmt2a
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048591.1
NCBI id CM023245.2
chromosome length 51556237
location 5564294 ~ 5564534 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2339008
CGACGTTGCCACTGCTGGCACAGAGGAAGCAGACGACCCGCGGGGTGATTGGCACGGAGGTGAGGAGGCCGAGGCCGCCCGTGGCCCACACGTTTTCCACGTCATGGTCCTTCTTAAAATCCACTCTGATTCTGTGCACTCCGTCGCAGGGCACTTTCTGCTTGGCGGTGCCCCCAGTCGAGGGAGTGCTCAGCAAGTTTAAAGTACTGCTCTCAGGTTTGGTGGCCAACGGCTTCTGCTG

Function

symbol description
kmt2a Predicted to enable histone methyltransferase activity (H3-K4 specific). Acts upstream of or within glial cell development; nucleate erythrocyte development; and paraxial mesoderm development. Predicted to be located in nucleus. Predicted to be part of histone methyltransferase complex. Is expressed in several structures, including blastoderm; blastodisc; intermediate cell mass of mesoderm; nervous system; and renal system. Human ortholog(s) of this gene implicated in acute myeloid leukemia; cervical cancer; mixed phenotype acute leukemia; and non-Hodgkin lymphoma. Orthologous to human KMT2A (lysine methyltransferase 2A).

NR:

description
histone-lysine N-methyltransferase 2A-like isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2339008 True 241 lncRNA 0.60 1 5564294 5564534

Neighbor

gene id symbol gene type direction distance location
LOC110507053 rnf26 coding upstream 52546 5505817 ~ 5511748 (+)
cbl cbl coding upstream 125230 5375556 ~ 5514824 (+)
LOC110507051 LOC106612471 coding upstream 233371 4879928 ~ 5330923 (+)
LOC118944797 NA coding upstream 253288 5310954 ~ 5311006 (+)
LOC110507382 NA coding upstream 705706 4790174 ~ 4858588 (+)
LOC110507391 arcn1 coding downstream 176728 5741262 ~ 5751139 (+)
LOC110507055 lxn coding downstream 192073 5756607 ~ 5764256 (+)
LOC110507392 itpkc coding downstream 205078 5769612 ~ 5794438 (+)
snrpa snrpa coding downstream 234079 5798613 ~ 5801513 (+)
LOC110507396 LOC106612485 coding downstream 258112 5822646 ~ 5870186 (+)
G2044757 NA non-coding upstream 762 5563286 ~ 5563532 (+)
G2044756 NA non-coding upstream 2881 5561207 ~ 5561413 (+)
G2044754 NA non-coding upstream 6994 5556957 ~ 5557300 (+)
G2044753 NA non-coding upstream 9370 5554713 ~ 5554924 (+)
G2044749 NA non-coding upstream 15626 5548360 ~ 5548668 (+)
G2044759 NA non-coding downstream 350 5564884 ~ 5565103 (+)
G2044763 NA non-coding downstream 2228 5566762 ~ 5567318 (+)
G2044764 NA non-coding downstream 3060 5567594 ~ 5567828 (+)
G2044765 NA non-coding downstream 10650 5575184 ~ 5575401 (+)
G2044771 NA non-coding downstream 14382 5578916 ~ 5579126 (+)
LOC110507374 spa17 other upstream 871422 4685868 ~ 4692872 (+)
G2043193 NA other upstream 1158168 4405458 ~ 4406126 (+)
G2040882 NA other upstream 2725367 2834096 ~ 2838927 (+)
LOC110507334 LOC106612406 other upstream 2748953 2813649 ~ 2815411 (+)
G2040863 NA other upstream 2762293 2799781 ~ 2802001 (+)
LOC110507397 sfr16 other downstream 327313 5874691 ~ 5896127 (+)
LOC110507398 znf296 other downstream 332983 5897208 ~ 5910058 (+)
G2045522 NA other downstream 930299 6494833 ~ 6495134 (+)
G2045655 NA other downstream 1128010 6692544 ~ 6693044 (+)
G2045665 NA other downstream 1155230 6719764 ~ 6720692 (+)

Expression


Co-expression Network