G2045197



Basic Information


Item Value
gene id G2045197
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048591.1
NCBI id CM023245.2
chromosome length 51556237
location 5814971 ~ 5815223 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2339510
cggagatttgtcttccaacaagacaatgatccaaaacataaagcaaaatctacaatggaatggttcaaaaataaacatatccaggtgttagaatggtccagacctgaatccaatcgagaatctgtggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgagctcgagctgttttgcaaggaggaatgggaaaaaatgtcagtctctcgatgtgcaaaactgatagagacatacccc

Function


NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2339510 True 253 lncRNA 0.41 1 5814971 5815223
Loading

Neighbor


gene id symbol gene type direction distance location
c27h19orf54 clg01h19orf54 coding downstream 16479 5795135 ~ 5798492 (-)
LOC118944669 gfm1 coding downstream 48139 5759611 ~ 5766832 (-)
LOC110507390 LOC106612480 coding downstream 80606 5720390 ~ 5734365 (-)
LOC110507389 LOC105011778 coding downstream 104882 5679726 ~ 5710089 (-)
LOC110507260 nlrx1 coding downstream 178073 5635480 ~ 5636898 (-)
LOC110507406 map3k10 coding upstream 253201 6068424 ~ 6105009 (-)
LOC110507409 LOC106612510 coding upstream 407704 6222927 ~ 6224524 (-)
LOC110507410 LOC106612495 coding upstream 412890 6228113 ~ 6235871 (-)
LOC110507423 NA coding upstream 516054 6331277 ~ 6334277 (-)
LOC110507420 mrpl28 coding upstream 533921 6349144 ~ 6351899 (-)
G2045193 NA non-coding downstream 6295 5808386 ~ 5808676 (-)
G2045191 NA non-coding downstream 8315 5806176 ~ 5806656 (-)
G2045188 NA non-coding downstream 11875 5802878 ~ 5803096 (-)
G2045187 NA non-coding downstream 12157 5802418 ~ 5802814 (-)
G2045090 NA non-coding downstream 60929 5753656 ~ 5754042 (-)
G2045202 NA non-coding upstream 7465 5822688 ~ 5823546 (-)
G2045203 NA non-coding upstream 9786 5825009 ~ 5825238 (-)
G2045204 NA non-coding upstream 10066 5825289 ~ 5825503 (-)
G2045223 LOC106612485 non-coding upstream 53685 5868575 ~ 5870139 (-)
G2045224 NA non-coding upstream 55649 5870872 ~ 5871086 (-)
kmt2a kmt2a other downstream 273338 5531877 ~ 5586139 (-)
G2043518 NA other downstream 1400548 4414065 ~ 4414423 (-)
G2043483 NA other downstream 1435542 4378934 ~ 4379429 (-)
G2043460 NA other downstream 1466562 4343599 ~ 4348409 (-)
LOC110507356 LOC106580682 other downstream 2273218 3539029 ~ 3718487 (-)
LOC110507421 gemin7 other upstream 674499 6489704 ~ 6491119 (-)
LOC110507418 NA other upstream 687192 6501784 ~ 6512110 (-)
LOC110507058 egln2 other upstream 1177160 6992367 ~ 7028249 (-)

Expression


G2045197 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G2045197 Expression in each Bioproject

Bar chart with 19 bars.
G2045197 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network