G2045665



Basic Information


Item Value
gene id G2045665
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048591.1
NCBI id CM023245.2
chromosome length 51556237
location 6719764 ~ 6720692 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2340054
cttttttaacaaatcaaaaactgaaaaattgggcgtgcaaaattattcagcccctttactttcagtgcagcaaactctctccagaagttcagtgaggatctctgaatgatccaatgttgacctaaatgactaatgatgataaatacaatccacctgtgtgtaatcaagtcaccgtataaatgcacctgcactgtgatagtctcagaggtccgttaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcaggtccgagatactgttgtgaagaagtttaaagccggatttggatacaaaaagatttcccaagctttaaacatcccaaggagcactgtgcaagcgataatattgaaatggaaggagtatcagaccactgcaaatctaccaagacctggccgtccctctaaactttcagctcatacaaggagaagactgatcagagatgcagccaagaggcccatgatcactctggatgaactgcagagatctacagctgaggtgggagactctgtccataggacaacaatcagtcgtatattgcacaaatctggcctttatggaagagtggcaagaagaaagccatttcttaaagatatccataaaaagtgttgtttaaagtttgccacaagccatctgggagacacactaaacatgtggaagaaggtgctctggtcagatgaacccaaaattgaactttttggcaacaatgcaaaacgttatgtttggcgtaaaagcaacacagctgaacacaccatccccactgtcaaacatggtggtggcagcatcatggtttgggcctgcttttcttcagcagggacagggaagatggttaaaattgatgggaagatggatggagccaaatacaggaccattctggaagaaaacctgatggagtctgcaaaagacctgagactgggac

Function


NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2340054 True 929 TUCP 0.43 1 6719764 6720692
Loading

Neighbor


gene id symbol gene type direction distance location
rtn2a NA coding upstream 500 6706664 ~ 6719264 (+)
calm3a LOC107670363 coding upstream 127237 6576429 ~ 6592527 (+)
LOC110507417 NA coding upstream 150521 6529755 ~ 6569243 (+)
LOC110507414 relb coding upstream 377955 6334332 ~ 6341809 (+)
LOC110507416 NA coding upstream 395284 6295838 ~ 6324480 (+)
rhoub LOC106612375 coding downstream 4977 6725669 ~ 6734192 (+)
rab4b LOC106612374 coding downstream 73227 6793919 ~ 6811036 (+)
arhgap35a LOC106612372 coding downstream 92157 6812849 ~ 6907589 (+)
LOC110507056 npas1 coding downstream 216217 6936909 ~ 6974629 (+)
LOC110507436 slc1a5 coding downstream 367356 7088048 ~ 7101257 (+)
G2045560 NA non-coding upstream 28379 6691075 ~ 6691385 (+)
G2045653 NA non-coding upstream 29776 6689725 ~ 6689988 (+)
G2045652 NA non-coding upstream 30202 6689292 ~ 6689562 (+)
G2045651 NA non-coding upstream 30673 6687212 ~ 6689091 (+)
G2045598 NA non-coding upstream 98119 6617801 ~ 6621645 (+)
G2045674 NA non-coding downstream 15749 6736441 ~ 6736706 (+)
G2045686 NA non-coding downstream 40881 6761573 ~ 6761981 (+)
G2045688 NA non-coding downstream 47530 6768222 ~ 6768535 (+)
G2045689 NA non-coding downstream 47994 6768686 ~ 6769032 (+)
G2045690 NA non-coding downstream 54968 6775660 ~ 6775938 (+)
G2045655 NA other upstream 26720 6692544 ~ 6693044 (+)
G2045522 NA other upstream 224630 6494833 ~ 6495134 (+)
LOC110507398 znf296 other upstream 812525 5897208 ~ 5910058 (+)
LOC110507397 sfr16 other upstream 823651 5874691 ~ 5896127 (+)
LOC110507374 spa17 other upstream 2026892 4685868 ~ 4692872 (+)
G2046345 NA other downstream 525114 7245806 ~ 7251575 (+)
G2046384 LOC106612398 other downstream 535939 7256631 ~ 7258230 (+)
si:cabz01090165.1 LOC106580728 other downstream 1886801 8606550 ~ 8741534 (+)
G2049339 LOC100380674 other downstream 2686933 9407625 ~ 9408571 (+)
G2049657 NA other downstream 3067114 9787806 ~ 9788115 (+)

Expression


G2045665 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G2045665 Expression in each Bioproject

Bar chart with 20 bars.
G2045665 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network