G2046706



Basic Information


Item Value
gene id G2046706
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048591.1
NCBI id CM023245.2
chromosome length 51556237
location 6960323 ~ 6960625 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2341195
taacggacctctgagactatcacagtgcaggtgcatttatacggagacttgattacacacaggtggattgtatttatcatcattagtcatttaggtcaacattggatcattcagagatcctcactgaacttctggagagagtttgctgcactgaaagtaaagggactgaataattttgcacgcccaatttttcagtttttgatttgttaaaaaagtttgaaatatccaataaatgtcgttccacttcatgattgtgtcccacttgttgttgattcttcacaaaaaatacagttttatatcttt

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2341195 True 303 lncRNA 0.36 1 6960323 6960625

Neighbor


gene id symbol gene type direction distance location
ap2s1 AP2S1 coding downstream 143734 6811406 ~ 6816589 (-)
LOC118944637 NA coding downstream 200018 6757635 ~ 6760305 (-)
LOC110507428 LOC106612376 coding downstream 255790 6694165 ~ 6704533 (-)
LOC110507427 NA coding downstream 266303 6688521 ~ 6694030 (-)
ptgir ptgir coding downstream 288163 6610446 ~ 6672160 (-)
tmem160 tmem160 coding upstream 25015 6985640 ~ 6988182 (-)
LOC110507058 egln2 coding upstream 31742 6992367 ~ 7028249 (-)
LOC110507438 LOC106612392 coding upstream 142886 7103511 ~ 7108254 (-)
LOC110507441 LOC106612399 coding upstream 257995 7218620 ~ 7225752 (-)
LOC110507059 dscaml1 coding upstream 291176 7182085 ~ 7411701 (-)
G2046702 npas1 non-coding downstream 8823 6951115 ~ 6951500 (-)
G2046701 NA non-coding downstream 9291 6950801 ~ 6951032 (-)
G2046700 NA non-coding downstream 10351 6949718 ~ 6949972 (-)
G2046699 NA non-coding downstream 15634 6944335 ~ 6944689 (-)
G2046697 NA non-coding downstream 20711 6939404 ~ 6939612 (-)
G2046710 npas1 non-coding upstream 10126 6970751 ~ 6971927 (-)
G2046745 NA non-coding upstream 115348 7075973 ~ 7076190 (-)
G2046749 NA non-coding upstream 119918 7080543 ~ 7080758 (-)
G2046685 slc1a5 non-coding upstream 127716 7088341 ~ 7088966 (-)
G2046688 slc1a5 non-coding upstream 135880 7096505 ~ 7096808 (-)
LOC110507418 NA other downstream 452742 6501784 ~ 6512110 (-)
LOC110507421 gemin7 other downstream 469204 6489704 ~ 6491119 (-)
LOC110507410 LOC106612495 other downstream 724801 6228113 ~ 6235871 (-)
G2045223 LOC106612485 other downstream 1090184 5868575 ~ 5870139 (-)
kmt2a kmt2a other downstream 1418690 5531877 ~ 5586139 (-)
fxyd6 fxyd6 other upstream 482048 7442657 ~ 7468560 (-)
G2046935 NA other upstream 545094 7505719 ~ 7510925 (-)
LOC110507449 LOC106580720 other upstream 843258 7803655 ~ 7904639 (-)

Expression


G2046706 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G2046706 Expression in each Bioproject

Bar chart with 16 bars.
G2046706 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network