G2048925 (sptbn4)


Basic Information

Item Value
gene id G2048925
gene name sptbn4
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048591.1
NCBI id CM023245.2
chromosome length 51556237
location 9069042 ~ 9069300 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2343554
CCTTTTCCTCGTTCATCATGTGCAGCTCCTGTTCGCTGAGCCAGGCCTCCACCTCGGCCGTGTCAAAGTAGTACTGCTGGGCCTGGTACATGGCATCCAGCACCAGCTGTCTTCTCTCCGTCTCGGCCCACAGCAGACCCCACAGCCTGCTGAGCTGCTCCAGGCCCGCCCGCACACAGTCAGCCTGGGGGCTGCGGATGGAGGCGATGACATTAGCTCTTTCCAGGACGTCCTCCACCCTCGCCCGATGGCCCTGTAG

Function

symbol description
sptbn4 Enables ankyrin binding activity and phosphatase binding activity. Predicted to be involved in several processes, including adult walking behavior; neuron development; and regulation of heart contraction. Predicted to act upstream of or within several processes, including adult behavior; fertilization; and regulation of growth. Located in cytoplasm; membrane; and nuclear lumen. Part of spectrin.

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2343554 True 259 lncRNA 0.63 1 9069042 9069300

Neighbor

gene id symbol gene type direction distance location
esrrd LOC106580735 coding upstream 25363 9036968 ~ 9043679 (+)
LOC110507061 ltbp4 coding upstream 35934 8958406 ~ 9033108 (+)
LOC110507459 LOC106580729 coding upstream 277229 8788596 ~ 8791813 (+)
si:cabz01090165.1 LOC106580728 coding upstream 327513 8606550 ~ 8741534 (+)
LOC110507457 bl1s3 coding upstream 776856 8287448 ~ 8292186 (+)
LOC110507468 blvrb coding downstream 54296 9123596 ~ 9126312 (+)
LOC110507469 sertad3 coding downstream 58731 9128031 ~ 9130735 (+)
LOC110507063 hipk4 coding downstream 140454 9209754 ~ 9212063 (+)
LOC110507479 LOC106580747 coding downstream 202541 9271841 ~ 9273709 (+)
LOC110507484 LOC106580753 coding downstream 437185 9506485 ~ 9538992 (+)
G2048924 NA non-coding upstream 298 9068497 ~ 9068744 (+)
G2048873 sptbn4 non-coding upstream 1081 8973119 ~ 9067961 (+)
G2048859 NA non-coding upstream 114946 8953773 ~ 8954096 (+)
G2048806 NA non-coding upstream 157466 8911374 ~ 8911576 (+)
G2048803 NA non-coding upstream 159479 8909321 ~ 8909563 (+)
G2048926 sptbn4 non-coding downstream 526 9069826 ~ 9070122 (+)
G2048942 sptbn4 non-coding downstream 28138 9097438 ~ 9098286 (+)
G2048957 NA non-coding downstream 52468 9121768 ~ 9122180 (+)
G2049072 NA non-coding downstream 66255 9135555 ~ 9139211 (+)
G2049089 NA non-coding downstream 86121 9155421 ~ 9156365 (+)
G2046384 LOC106612398 other upstream 1810812 7256631 ~ 7258230 (+)
G2046345 NA other upstream 1817467 7245806 ~ 7251575 (+)
G2045665 NA other upstream 2348350 6719764 ~ 6720692 (+)
G2045655 NA other upstream 2375998 6692544 ~ 6693044 (+)
G2049339 LOC100380674 other downstream 338325 9407625 ~ 9408571 (+)
G2049657 NA other downstream 718506 9787806 ~ 9788115 (+)
LOC110507067 LOC106580782 other downstream 1209810 10251889 ~ 10282483 (+)
LOC110507523 LOC106580787 other downstream 1319701 10384807 ~ 10390951 (+)
LOC110507524 LOC106612657 other downstream 1337073 10391240 ~ 10417311 (+)

Expression


Co-expression Network