G2051034



Basic Information


Item Value
gene id G2051034
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048591.1
NCBI id CM023245.2
chromosome length 51556237
location 10992985 ~ 10993588 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2345997
cggaagagtctggtcgactggcggatccggaagagtctggtcgactggcggatccggaagagtctggtcgactggcggatccggaagagtctggtcgactggcggatctggaagattctggtcgactggcggatctggaagattctggtcgactggcggatctggaagagtctggtcgactggcagatctggaagagtctggtcgactggcagatctggaagagtctggtcgactggctgctctggctgctccatgctgactggctgctccatgatgactggcagctctggctgctccatgctgactggctgctccatgctgactggcagctctggctgctccatgctgactggctgctctggctgctccatgctgactggctgctccatgctgactggcggccctggctgctccatgctgactggcggccctggctgctccatgctgactggcggccctggctgctccatgctgactggcggccctggctgctcc

Function


NR:

description
PREDICTED: major latex allergen Hev b 5-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2345997 True 496 TUCP 0.63 2 10992985 10993588
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118944743 NA coding upstream 21802 10966933 ~ 10971183 (+)
LOC110507544 LOC106580804 coding upstream 79763 10814920 ~ 10913222 (+)
LOC110507543 NA coding upstream 180979 10809948 ~ 10812006 (+)
LOC110507542 LOC106580802 coding upstream 187449 10787642 ~ 10805536 (+)
LOC110507540 git1 coding upstream 214582 10755190 ~ 10778403 (+)
cd3e LOC100499597 coding downstream 1195745 12189333 ~ 12193259 (+)
LOC110507553 LOC106580818 coding downstream 1288730 12282318 ~ 12303781 (+)
apoa-i-1 apoa-i-1 coding downstream 1350217 12343805 ~ 12346332 (+)
LOC110507554 LOC106580899 coding downstream 1354797 12348385 ~ 12353409 (+)
LOC110507072 LOC106580819 coding downstream 1359969 12353557 ~ 12368584 (+)
G2050996 NA non-coding upstream 38607 10954172 ~ 10954378 (+)
G2050993 NA non-coding upstream 39753 10952999 ~ 10953232 (+)
G2050988 NA non-coding upstream 42279 10950503 ~ 10950706 (+)
G2050394 NA non-coding upstream 153313 10834153 ~ 10839672 (+)
G2051041 NA non-coding downstream 8273 11001861 ~ 11002289 (+)
G2051422 NA non-coding downstream 546867 11540455 ~ 11777397 (+)
G2051500 NA non-coding downstream 638303 11631891 ~ 11697754 (+)
G2051892 NA non-coding downstream 1144592 12138180 ~ 12138453 (+)
G2051895 NA non-coding downstream 1148469 12142057 ~ 12174770 (+)
rap1gap2a LOC106580794 other upstream 409900 10494894 ~ 10583085 (+)
LOC110507524 LOC106612657 other upstream 575690 10391240 ~ 10417311 (+)
LOC110507523 LOC106580787 other upstream 602084 10384807 ~ 10390951 (+)
LOC110507067 LOC106580782 other upstream 710502 10251889 ~ 10282483 (+)
G2051018 LOC106580809 other downstream 1133853 12127441 ~ 12137799 (+)
nudt8 LOC106580825 other downstream 1444371 12436060 ~ 12439501 (+)
G2053443 NA other downstream 1984939 12978527 ~ 12978923 (+)
LOC110507618 LOC107659943 other downstream 2561152 13554250 ~ 13575495 (+)
LOC110507180 LOC106612536 other downstream 3831932 14825520 ~ 14841123 (+)

Expression


G2051034 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G2051034 Expression in each Bioproject

Bar chart with 21 bars.
G2051034 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network