G2061538



Basic Information


Item Value
gene id G2061538
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048591.1
NCBI id CM023245.2
chromosome length 51556237
location 20748750 ~ 20748949 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2357657
atctatgcatagtcactttaataactctacctacatgcacatattacctcaattacctcgactaaccggtgcctcctcacattaactctgtaccggtaccccctgtataaggtctcactattgttattttactgctgctctttaattgtttgttactttttttaggtatttttcttgaaactgcattgttggctaagggc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2357657 True 200 lncRNA 0.38 1 20748750 20748949

Neighbor


gene id symbol gene type direction distance location
LOC110507746 LOC106581201 coding upstream 4490 20740943 ~ 20744260 (+)
c2cd3 c2cd3 coding upstream 8187 20717049 ~ 20740563 (+)
LOC110507744 p4ha3 coding upstream 40116 20697519 ~ 20708634 (+)
or129-1 LOC106581076 coding upstream 51605 20696180 ~ 20697145 (+)
LOC110507123 LOC106581088 coding upstream 72049 20675451 ~ 20676701 (+)
camkk1b LOC106581199 coding downstream 5268 20754217 ~ 20775966 (+)
si:ch211-105f12.2 LOC106581198 coding downstream 52765 20801714 ~ 20804283 (+)
LOC110507750 dhr11 coding downstream 87673 20836622 ~ 20839521 (+)
LOC110507751 LOC106581197 coding downstream 90747 20839696 ~ 20870287 (+)
zgc:174895 LOC106612798 coding downstream 136807 20885756 ~ 20898716 (+)
G2061442 NA non-coding upstream 33059 20596557 ~ 20715691 (+)
G2061490 NA non-coding upstream 87748 20660079 ~ 20661002 (+)
G2061394 NA non-coding upstream 193212 20554331 ~ 20555538 (+)
G2061378 NA non-coding upstream 246664 20501861 ~ 20502086 (+)
G2061375 NA non-coding upstream 255567 20492780 ~ 20493183 (+)
G2061552 143g2 non-coding downstream 40067 20789016 ~ 20792962 (+)
G2061579 NA non-coding downstream 74479 20823428 ~ 20823896 (+)
G2061675 NA non-coding downstream 257404 21006353 ~ 21006589 (+)
G2062371 NA non-coding downstream 330229 21079178 ~ 21091364 (+)
LOC110507758 NA non-coding downstream 344208 21093106 ~ 21097607 (+)
G2061226 NA other upstream 442142 20305382 ~ 20306608 (+)
LOC110507725 LOC106581066 other upstream 688782 20058224 ~ 20059968 (+)
G2059777 LOC106581039 other upstream 1553566 19193457 ~ 19195184 (+)
G2059714 NA other upstream 1656478 19091947 ~ 19092272 (+)
G2062402 NA other downstream 396262 21145211 ~ 21146366 (+)
G2062531 NA other downstream 531211 21280160 ~ 21281860 (+)
LOC110507128 LOC106581176 other downstream 673763 21420062 ~ 21437148 (+)
G2062912 LOC106612935 other downstream 949121 21698070 ~ 21720726 (+)
G2062917 NA other downstream 960949 21709898 ~ 21723142 (+)

Expression


G2061538 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G2061538 Expression in each Bioproject

Bar chart with 7 bars.
G2061538 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.

Co-expression Network