G2069842



Basic Information


Item Value
gene id G2069842
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048591.1
NCBI id CM023245.2
chromosome length 51556237
location 27540000 ~ 27540609 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2366760
ctttgaaaataatctgcgaaaaggaccttggtctgactatcagtgatgagttatgggcagaggtttgcgacagggtatactgctcctctaccagtgtaaaaatgaaagaatctaattacacatttttgtacaaattgtattatactcctttgagactccatagaatgaaaacagatatgtctcctaactgtaaaagatgtacctctgaaagtggaacctatatgcatgtattttggagctgtacatactgctgcacagaaaatactagcggtacagtttgatatgaccccgtgtatctatcttcttaatgcccagcagaactttgttcttgatcctgacagagaaaatttgcttatgactattacatactttgctaagaaaggtattcttctattgtgggcctcaaatacccctcctacatttaaaatgtggattgaccagattgttgactttcttcctcttgaaaagctcacttatgacctccacaagagacagcccaagtttgatagactctggtcttcactattcaactatatttcaaactggacagagtgaacggggtgactagggaaatgcgcaga

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2366760 True 581 TUCP 0.39 2 27540000 27540609

Neighbor


gene id symbol gene type direction distance location
LOC110507889 LOC106581258 coding downstream 5764 27517351 ~ 27534236 (-)
LOC110507887 LOC106581252 coding downstream 39949 27448217 ~ 27500051 (-)
LOC110507886 LOC106581251 coding downstream 92456 27428483 ~ 27447544 (-)
LOC110507885 LOC106581250 coding downstream 135620 27333102 ~ 27404380 (-)
LOC100135795 LOC100135795 coding downstream 209535 27318991 ~ 27330465 (-)
LOC118944649 LOC106581256 coding upstream 162045 27702654 ~ 27738528 (-)
LOC118944710 NA coding upstream 210176 27750785 ~ 27751274 (-)
LOC118944701 LOC106581256 coding upstream 219093 27759702 ~ 27763326 (-)
LOC118944708 LOC106581256 coding upstream 232742 27773351 ~ 27774663 (-)
LOC118944699 LOC106581256 coding upstream 238195 27778804 ~ 27780466 (-)
G2069731 NA non-coding downstream 145006 27394424 ~ 27394994 (-)
G2069679 NA non-coding downstream 206969 27287692 ~ 27333031 (-)
G2069672 NA non-coding downstream 256884 27282799 ~ 27283116 (-)
G2069871 NA non-coding upstream 78931 27619540 ~ 27664128 (-)
G2069879 LOC106581256 non-coding upstream 102047 27642656 ~ 27665300 (-)
G2069894 NA non-coding upstream 129513 27670122 ~ 27670402 (-)
G2069910 NA non-coding upstream 130234 27670843 ~ 27671082 (-)
G2069913 NA non-coding upstream 134062 27674671 ~ 27674917 (-)
G2068676 NA other downstream 1214521 26325130 ~ 26325479 (-)
G2068043 NA other downstream 1705899 25818639 ~ 25834101 (-)
LOC118944698 LOC106581256 other upstream 328615 27866010 ~ 27871529 (-)
LOC118944653 LOC106581256 other upstream 332100 27872709 ~ 27889358 (-)
G2070530 NA other upstream 630229 28170838 ~ 28172542 (-)
G2070744 NA other upstream 983337 28523946 ~ 28524550 (-)
G2071247 LOC106581281 other upstream 1400745 28941354 ~ 28942728 (-)

Expression


G2069842 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G2069842 Expression in each Bioproject

Bar chart with 17 bars.
G2069842 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network