G2069910



Basic Information


Item Value
gene id G2069910
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048591.1
NCBI id CM023245.2
chromosome length 51556237
location 27670843 ~ 27671082 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2366832
GCTCGTCGAATCTGTTTATCACGGCCTGAACCCATTCCACTGGTTTATGTGCCGCCATGGCCGTGCGGATAGAAACCGCGAATGACTGCTTGCAATTCCAAGACGAATGTGGACGTTCGTGGCGATGTTAGGCCTGAAATAAGTCCCAAAACCGGCGTCTGAAGATGACAGTACGGCTTGGTTATTGTTCCCTTTGAGCAAGCTTTACCATGCCGCCATGACACACCACCGGAAGTCTTC

Function


NR:

description
PREDICTED: neurofibromin-like, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2366832 True 240 lncRNA 0.52 1 27670843 27671082
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110507889 LOC106581258 coding downstream 136607 27517351 ~ 27534236 (-)
LOC110507887 LOC106581252 coding downstream 170792 27448217 ~ 27500051 (-)
LOC110507886 LOC106581251 coding downstream 223299 27428483 ~ 27447544 (-)
LOC110507885 LOC106581250 coding downstream 266463 27333102 ~ 27404380 (-)
LOC100135795 LOC100135795 coding downstream 340378 27318991 ~ 27330465 (-)
LOC118944649 LOC106581256 coding upstream 31572 27702654 ~ 27738528 (-)
LOC118944710 NA coding upstream 79703 27750785 ~ 27751274 (-)
LOC118944701 LOC106581256 coding upstream 88620 27759702 ~ 27763326 (-)
LOC118944708 LOC106581256 coding upstream 102269 27773351 ~ 27774663 (-)
LOC118944699 LOC106581256 coding upstream 107722 27778804 ~ 27780466 (-)
G2069894 NA non-coding downstream 441 27670122 ~ 27670402 (-)
G2069879 LOC106581256 non-coding downstream 5543 27642656 ~ 27665300 (-)
G2069871 NA non-coding downstream 6715 27619540 ~ 27664128 (-)
G2069731 NA non-coding downstream 275849 27394424 ~ 27394994 (-)
G2069913 NA non-coding upstream 3589 27674671 ~ 27674917 (-)
G2069916 NA non-coding upstream 12748 27683830 ~ 27686291 (-)
G2069917 NA non-coding upstream 15568 27686650 ~ 27686929 (-)
G2069919 NA non-coding upstream 26333 27697415 ~ 27697618 (-)
G2069920 NA non-coding upstream 26597 27697679 ~ 27697936 (-)
G2069842 NA other downstream 130234 27540000 ~ 27540609 (-)
G2068676 NA other downstream 1345364 26325130 ~ 26325479 (-)
LOC118944698 LOC106581256 other upstream 198142 27866010 ~ 27871529 (-)
LOC118944653 LOC106581256 other upstream 201627 27872709 ~ 27889358 (-)
G2070530 NA other upstream 499756 28170838 ~ 28172542 (-)
G2070744 NA other upstream 852864 28523946 ~ 28524550 (-)
G2071247 LOC106581281 other upstream 1270272 28941354 ~ 28942728 (-)

Expression


G2069910 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G2069910 Expression in each Bioproject

Bar chart with 8 bars.
G2069910 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network