G2069919



Basic Information


Item Value
gene id G2069919
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048591.1
NCBI id CM023245.2
chromosome length 51556237
location 27697415 ~ 27697618 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2366841
cttgtctttcccagttatttttacattttgttcacgcctacatgaataatcattttttttaaatttatttttaaagcattgtaaactttttttttgtccagtggatggtcggtctgtggccatgactgtctgtgagtggctgcatttctccacccttatcccttgactgtttacaggaacaatggtgaggtgtttgctctgtcc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2366841 True 204 lncRNA 0.38 1 27697415 27697618

Neighbor


gene id symbol gene type direction distance location
LOC110507889 LOC106581258 coding downstream 163179 27517351 ~ 27534236 (-)
LOC110507887 LOC106581252 coding downstream 197364 27448217 ~ 27500051 (-)
LOC110507886 LOC106581251 coding downstream 249871 27428483 ~ 27447544 (-)
LOC110507885 LOC106581250 coding downstream 293035 27333102 ~ 27404380 (-)
LOC100135795 LOC100135795 coding downstream 366950 27318991 ~ 27330465 (-)
LOC118944649 LOC106581256 coding upstream 5036 27702654 ~ 27738528 (-)
LOC118944710 NA coding upstream 53167 27750785 ~ 27751274 (-)
LOC118944701 LOC106581256 coding upstream 62084 27759702 ~ 27763326 (-)
LOC118944708 LOC106581256 coding upstream 75733 27773351 ~ 27774663 (-)
LOC118944699 LOC106581256 coding upstream 81186 27778804 ~ 27780466 (-)
G2069917 NA non-coding downstream 10486 27686650 ~ 27686929 (-)
G2069916 NA non-coding downstream 11124 27683830 ~ 27686291 (-)
G2069913 NA non-coding downstream 22498 27674671 ~ 27674917 (-)
G2069910 NA non-coding downstream 26333 27670843 ~ 27671082 (-)
G2069894 NA non-coding downstream 27013 27670122 ~ 27670402 (-)
G2069920 NA non-coding upstream 61 27697679 ~ 27697936 (-)
G2069922 NA non-coding upstream 757 27698375 ~ 27698706 (-)
G2069930 NA non-coding upstream 7475 27705093 ~ 27705366 (-)
G2069931 NA non-coding upstream 8184 27705802 ~ 27706215 (-)
G2069932 NA non-coding upstream 8883 27706501 ~ 27706701 (-)
G2069842 NA other downstream 156806 27540000 ~ 27540609 (-)
G2068676 NA other downstream 1371936 26325130 ~ 26325479 (-)
LOC118944698 LOC106581256 other upstream 171606 27866010 ~ 27871529 (-)
LOC118944653 LOC106581256 other upstream 175091 27872709 ~ 27889358 (-)
G2070530 NA other upstream 473220 28170838 ~ 28172542 (-)
G2070744 NA other upstream 826328 28523946 ~ 28524550 (-)
G2071247 LOC106581281 other upstream 1243736 28941354 ~ 28942728 (-)

Expression


G2069919 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G2069919 Expression in each Bioproject

Bar chart with 13 bars.
G2069919 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 12.
End of interactive chart.

Co-expression Network