G2071617



Basic Information


Item Value
gene id G2071617
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048591.1
NCBI id CM023245.2
chromosome length 51556237
location 29379764 ~ 29379983 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2368743
gacataacattacgttatccataccaccagagtctggagggagacctgtatcagatagacagatcatctggagacataacattacgttatccataccaccagagtctggagggagacctgtatcatatagacagatcatctggagacataacattacgttatccataccaccagagtctggagggagacctgtatcagatggacagatcatctggagaca

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2368743 True 220 lncRNA 0.45 1 29379764 29379983
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110507926 LOC106581290 coding upstream 26492 29301663 ~ 29353272 (+)
LOC110507927 LOC106581292 coding upstream 88429 29285656 ~ 29291335 (+)
ccdc150 ccdc150 coding upstream 408187 28950404 ~ 28971577 (+)
cep295 LOC106581281 coding upstream 429794 28936830 ~ 28949970 (+)
LOC110507912 LOC106581280 coding upstream 446309 28924066 ~ 28933455 (+)
LOC110507925 LOC105015878 coding downstream 18718 29398701 ~ 29609924 (+)
prss16 LOC106581020 coding downstream 397789 29777772 ~ 29821755 (+)
serpine2 LOC100196662 coding downstream 447017 29827000 ~ 29833892 (+)
wdfy1 LOC106613124 coding downstream 457339 29837322 ~ 29854381 (+)
LOC118944785 NA coding downstream 482749 29862732 ~ 29870795 (+)
G2071616 NA non-coding upstream 15822 29363721 ~ 29363942 (+)
G2071578 NA non-coding upstream 38395 29314646 ~ 29341369 (+)
G2071447 NA non-coding upstream 98263 29273728 ~ 29281501 (+)
G2071449 NA non-coding upstream 100816 29272107 ~ 29278948 (+)
G2071358 NA non-coding upstream 246577 29117670 ~ 29133187 (+)
G2071624 NA non-coding downstream 6937 29386920 ~ 29387129 (+)
G2071632 NA non-coding downstream 12384 29392367 ~ 29392623 (+)
G2071637 NA non-coding downstream 15097 29395080 ~ 29395301 (+)
G2071641 NA non-coding downstream 16591 29396574 ~ 29396785 (+)
G2071642 NA non-coding downstream 17811 29397794 ~ 29398064 (+)
G2070010 NA other upstream 1464748 27896590 ~ 27915016 (+)
G2070027 LOC106585521 other upstream 1471262 27907856 ~ 27908502 (+)
G2069953 NA other upstream 1651315 27727588 ~ 27728449 (+)
G2069949 NA other upstream 1657187 27722005 ~ 27722577 (+)
G2071807 NA other downstream 258896 29638879 ~ 29640299 (+)
G2072178 NA other downstream 631482 30011465 ~ 30014824 (+)
G2072515 NA other downstream 890128 30270111 ~ 30271997 (+)
G2074226 NA other downstream 2586035 31966018 ~ 31974065 (+)

Expression


G2071617 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G2071617 Expression in each Bioproject

Bar chart with 9 bars.
G2071617 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network