G2073855



Basic Information


Item Value
gene id G2073855
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048591.1
NCBI id CM023245.2
chromosome length 51556237
location 31588402 ~ 31588779 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2371274
ATACAGTACTGAGGAAGATTCAAACAGAGCGAATGGGTTCAACTGGGGTCTTCGTCATCATTGCCACTGGAAACACAAAGAGCAAGAGAAGAGACACGTTATTTCAACTGCAGACAGAGAATAGGGGACAATCTAAATACTGGTTGTGTGGGATGTAAATTGAATAGGGGAGGAAGGGTCAATTCCCTGTTTAAATTCAGACTTCTTGTGGGATGTAAATTGAATAGGGGAGGAAGGGTCAATTCCCTGTTTAAATTCAGACTTCTTGTGGGATGTAAATTGAATAGGGGAGGAAGGGTCAATTCCCCATTTAAATTCAGACTTCTTGTGGGATGTAAATTGAATAGGGGAGGAAGGGTCAATTCCCCGTTTAAATTC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2371274 True 378 lncRNA 0.42 1 31588402 31588779

Neighbor


gene id symbol gene type direction distance location
LOC110507962 LOC106613113 coding downstream 229919 31332276 ~ 31358483 (-)
LOC110507154 clstn2 coding downstream 387605 30751075 ~ 31200797 (-)
LOC118944654 LOC106613133 coding downstream 844741 30739780 ~ 30743661 (-)
LOC110507935 LOC106581306 coding downstream 863937 30683454 ~ 30724465 (-)
LOC118944677 NA coding downstream 979291 30607829 ~ 30609111 (-)
LOC110507961 LOC106581358 coding upstream 42768 31631547 ~ 31633359 (-)
LOC110507960 LOC106581357 coding upstream 47645 31636424 ~ 31638259 (-)
lpar5b LOC106581285 coding upstream 94148 31682927 ~ 31684215 (-)
gpr55a LOC106581353 coding upstream 100028 31688807 ~ 31695914 (-)
LOC110507954 NA coding upstream 114318 31701005 ~ 31707717 (-)
G2073812 NA non-coding downstream 999 31585835 ~ 31587403 (-)
G2073761 NA non-coding downstream 160557 31421213 ~ 31427845 (-)
G2073635 NA non-coding downstream 221462 31366731 ~ 31366940 (-)
G2073619 NA non-coding downstream 259575 31327646 ~ 31328827 (-)
G2073856 NA non-coding upstream 2784 31591563 ~ 31591990 (-)
G2073857 NA non-coding upstream 5281 31594060 ~ 31594313 (-)
G2073858 NA non-coding upstream 5824 31594603 ~ 31594821 (-)
G2073955 NA non-coding upstream 91804 31680583 ~ 31681907 (-)
G2073979 LOC100194703 non-coding upstream 96881 31685660 ~ 31685993 (-)
G2072732 NA other downstream 1191722 30395775 ~ 30396680 (-)
G2072288 LOC100196662 other downstream 1756693 29822517 ~ 29833885 (-)
zgc:165508 LOC106613118 other downstream 1936935 29626155 ~ 29651489 (-)
G2071247 LOC106581281 other downstream 2645674 28941354 ~ 28942728 (-)
G2070744 NA other downstream 3063852 28523946 ~ 28524550 (-)
G2074300 NA other upstream 438849 32027628 ~ 32027967 (-)
G2076236 NA other upstream 1290010 32878789 ~ 32880888 (-)
G2077617 NA other upstream 3527603 35116382 ~ 35154043 (-)
G2077934 NA other upstream 3846095 35434874 ~ 35435212 (-)
G2077936 NA other upstream 3846815 35435594 ~ 35436257 (-)

Expression


G2073855 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.25.
End of interactive chart.

G2073855 Expression in each Bioproject

Bar chart with 9 bars.
G2073855 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network