G2074217



Basic Information


Item Value
gene id G2074217
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048591.1
NCBI id CM023245.2
chromosome length 51556237
location 31958752 ~ 31959031 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2371716
atattatatacaaccccttcactctgttactgcttcactctgttgttactgcttaatattacatacaaccccttcactctgttactgcttaatattacatacaaccccttcactctgttactacttaatattacatacaaccccttcactctgttactgcttaatattacatacaaccccttcactctgttactgcttaatattacatacaaccccttcactctgttactacttaatattacatacaaccccttcactctgttactacttaatattacat

Function


NR:

description
PREDICTED: stress response protein NST1-like isoform X2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2371716 True 280 lncRNA 0.34 1 31958752 31959031
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118944767 NA coding upstream 87045 31870740 ~ 31871707 (+)
LOC110507951 LOC106581346 coding upstream 90452 31853996 ~ 31868448 (+)
efhd1 LOC106581350 coding upstream 187987 31748676 ~ 31770765 (+)
trnag-ucc-233 NA coding upstream 210400 31748281 ~ 31748352 (+)
trnaw-cca-60 NA coding upstream 211539 31747142 ~ 31747213 (+)
LOC110507983 LOC106581345 coding downstream 311175 32270206 ~ 32488659 (+)
LOC110507985 LOC106613152 coding downstream 569542 32528573 ~ 32591906 (+)
LOC110507986 NA coding downstream 984776 32943807 ~ 32963656 (+)
vwa7 LOC106581332 coding downstream 1120763 33079794 ~ 33093823 (+)
LOC110507993 LOC106581333 coding downstream 1146152 33105183 ~ 33111804 (+)
G2074214 NA non-coding upstream 639 31952063 ~ 31958113 (+)
G2074213 NA non-coding upstream 13006 31945330 ~ 31945746 (+)
G2074199 NA non-coding upstream 39625 31918900 ~ 31919127 (+)
G2074192 NA non-coding upstream 43712 31914694 ~ 31915040 (+)
G2074188 NA non-coding upstream 45308 31906482 ~ 31913444 (+)
G2074223 NA non-coding downstream 4094 31963125 ~ 31963433 (+)
G2074312 NA non-coding downstream 75100 32034131 ~ 32034693 (+)
G2074313 NA non-coding downstream 76075 32035106 ~ 32035363 (+)
G2074319 NA non-coding downstream 81326 32040357 ~ 32040615 (+)
G2074349 NA non-coding downstream 117061 32076092 ~ 32079842 (+)
G2072515 NA other upstream 1686755 30270111 ~ 30271997 (+)
G2072178 NA other upstream 1943928 30011465 ~ 30014824 (+)
G2071807 NA other upstream 2318453 29638879 ~ 29640299 (+)
LOC110507925 LOC105015878 other upstream 2431392 29398701 ~ 29609924 (+)
LOC110507926 LOC106581290 other upstream 2651620 29301663 ~ 29353272 (+)
G2074226 NA other downstream 6987 31966018 ~ 31974065 (+)
G2074227 NA other downstream 9506 31968537 ~ 31976501 (+)
G2074502 NA other downstream 237782 32196813 ~ 32197204 (+)
G2074577 NA other downstream 352959 32311990 ~ 32312276 (+)

Expression


G2074217 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G2074217 Expression in each Bioproject

Bar chart with 5 bars.
G2074217 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network