G2074226


Basic Information

Item Value
gene id G2074226
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048591.1
NCBI id CM023245.2
chromosome length 51556237
location 31966018 ~ 31974065 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2371726
gggaaattctaaattgatatgggagaatctaaaaaagttaacagggaaagaccatagtaacactgcaaaaagactagaaatcatggtgaataacaatctaacacaggatgcagtcgaaatagcaatagccttcaattcctactttattgactctgtcagggtactgacacagaacccctccacttgtttcttgggctcagtgctagtgaatgacactcaacctgtcttcatcataagggaggtttctgagtcaaaggtgaacaaggtgattagctcactaaagaactctaaagccaaagatgtgtttgggatggactctacctttcttaaaaactacaaagagtcactcattggccccattactaaggtcaccaacacatctattggtctcggtgtgtttccaagggtatggaagtcggccataataacggccatctttaaatcaggcgaccctgctgacgtgagtaactacaggcccattagtatactacctgtggtgtcaaaggttgttgaaaagtgtgtagcagaacaactgattgcccacctcaacaacagccccttcacattacacgccatgcagtttggcttcagagcgaaacactccacagaaacggccaactgctttcttctggaaaatgtgaagtccaagatggacaaagggggtgctgttggggctgtgtttctggacctaaggaaggcttttgat

Function

NR:

description
unnamed protein product

GO: NA

KEGG:

id description

RNA

RNA id representative length rna type GC content exon number start site end site
TU2371726 True 706 TUCP 0.44 2 31966018 31974065
Loading

Neighbor

gene id symbol gene type direction distance location
LOC118944767 NA coding upstream 94311 31870740 ~ 31871707 (+)
LOC110507951 LOC106581346 coding upstream 97718 31853996 ~ 31868448 (+)
efhd1 LOC106581350 coding upstream 195253 31748676 ~ 31770765 (+)
trnag-ucc-233 NA coding upstream 217666 31748281 ~ 31748352 (+)
trnaw-cca-60 NA coding upstream 218805 31747142 ~ 31747213 (+)
LOC110507983 LOC106581345 coding downstream 296141 32270206 ~ 32488659 (+)
LOC110507985 LOC106613152 coding downstream 554508 32528573 ~ 32591906 (+)
LOC110507986 NA coding downstream 969742 32943807 ~ 32963656 (+)
vwa7 LOC106581332 coding downstream 1105729 33079794 ~ 33093823 (+)
LOC110507993 LOC106581333 coding downstream 1131118 33105183 ~ 33111804 (+)
G2074223 NA non-coding upstream 2585 31963125 ~ 31963433 (+)
G2074217 NA non-coding upstream 6987 31958752 ~ 31959031 (+)
G2074214 NA non-coding upstream 7905 31952063 ~ 31958113 (+)
G2074213 NA non-coding upstream 20272 31945330 ~ 31945746 (+)
G2074199 NA non-coding upstream 46891 31918900 ~ 31919127 (+)
G2074312 NA non-coding downstream 60066 32034131 ~ 32034693 (+)
G2074313 NA non-coding downstream 61041 32035106 ~ 32035363 (+)
G2074319 NA non-coding downstream 66292 32040357 ~ 32040615 (+)
G2074349 NA non-coding downstream 102027 32076092 ~ 32079842 (+)
G2074416 NA non-coding downstream 141554 32115619 ~ 32116030 (+)
G2072515 NA other upstream 1694021 30270111 ~ 30271997 (+)
G2072178 NA other upstream 1951194 30011465 ~ 30014824 (+)
G2071807 NA other upstream 2325719 29638879 ~ 29640299 (+)
LOC110507925 LOC105015878 other upstream 2438658 29398701 ~ 29609924 (+)
LOC110507926 LOC106581290 other upstream 2658886 29301663 ~ 29353272 (+)
G2074502 NA other downstream 222748 32196813 ~ 32197204 (+)
G2074577 NA other downstream 337925 32311990 ~ 32312276 (+)
G2074650 NA other downstream 490173 32464238 ~ 32464876 (+)

Expression

G2074226 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G2074226 Expression in each Bioproject

Bar chart with 20 bars.
G2074226 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network