G2075409



Basic Information


Item Value
gene id G2075409
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048591.1
NCBI id CM023245.2
chromosome length 51556237
location 33348118 ~ 33432600 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2373008
atagagtacagtatatacatatacatatgagataaataatgtagggtatgtaaacattatattaggtagcattgtttaaagtggctagtgatatattttacatcaattcccatcaattcccattattaaagtggctggagttgagtcagtgtgttggcagcagccactcaatgttagtggtggctgtttaacagtctgatggccttgagatagaagctgtttttcagtctctcggtcccagctttgatgcacctgtactgacttcgccttctggatgatagcggggtgaacaggcagtggcttgggtggttgttgtccttgatgatctttatggccttcctgtgacatcgggtggtgtaggtgtcctggagggcagatagtttgcccccggtgatgcgttgtgcagacctcactaccctctggagagccttacggttgtgggcggagcagttgccgtaccaggcggtg

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2373008 True 468 lncRNA 0.47 2 33348118 33432600
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110507999 LOC100380744 coding upstream 152305 33184578 ~ 33195813 (+)
LOC110507998 LOC106581335 coding upstream 166728 33158868 ~ 33181390 (+)
LOC110507993 LOC106581333 coding upstream 236314 33105183 ~ 33111804 (+)
vwa7 LOC106581332 coding upstream 254295 33079794 ~ 33093823 (+)
LOC110507986 NA coding upstream 384462 32943807 ~ 32963656 (+)
LOC110507198 NA coding downstream 1329018 34761618 ~ 34766144 (+)
LOC110507199 LOC106613190 coding downstream 1389021 34821621 ~ 34827171 (+)
LOC110507268 LOC106593235 coding downstream 1429695 34862295 ~ 34863448 (+)
LOC110507201 NA coding downstream 1431143 34863743 ~ 34864743 (+)
LOC110507203 LOC106581388 coding downstream 1445919 34878519 ~ 34879765 (+)
G2075359 NA non-coding upstream 133547 33214353 ~ 33214571 (+)
G2075355 NA non-coding upstream 139551 33208363 ~ 33208567 (+)
G2075349 NA non-coding upstream 165261 33182554 ~ 33182857 (+)
G2075308 NA non-coding upstream 213691 33131841 ~ 33134427 (+)
G2075261 NA non-coding upstream 253159 33094587 ~ 33094959 (+)
G2075466 NA non-coding downstream 10041 33442641 ~ 33443117 (+)
G2075479 NA non-coding downstream 34995 33467595 ~ 33472335 (+)
G2075511 NA non-coding downstream 89033 33521633 ~ 33521876 (+)
G2075515 NA non-coding downstream 95077 33527677 ~ 33527947 (+)
G2075516 NA non-coding downstream 96070 33528670 ~ 33528877 (+)
G2075208 NA other upstream 357890 32988501 ~ 32990228 (+)
G2074973 NA other upstream 724150 32623624 ~ 32623968 (+)
LOC110507985 LOC106613152 other upstream 759346 32528573 ~ 32591906 (+)
G2074650 NA other upstream 883242 32464238 ~ 32464876 (+)
LOC110507983 LOC106581345 other upstream 899654 32270206 ~ 32488659 (+)
G2075508 NA other downstream 83641 33516241 ~ 33521004 (+)
G2075687 NA other downstream 384932 33817532 ~ 33817988 (+)
G2075724 NA other downstream 466677 33899277 ~ 33899623 (+)
robo1 robo1 other downstream 484148 33391192 ~ 33935721 (+)
G2076000 NA other downstream 1069649 34502249 ~ 34502705 (+)

Expression


G2075409 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G2075409 Expression in each Bioproject

Bar chart with 20 bars.
G2075409 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network