G2078218



Basic Information


Item Value
gene id G2078218
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048591.1
NCBI id CM023245.2
chromosome length 51556237
location 35827116 ~ 35827711 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2376118
cagccgtattcattgatctggccaaggctttcgactctgtcaatcaccacatcctcatcggcagactcaacagccttggtttctcaaatgattgcctcgcctggttcaccaactacttctctgatagagttcagtgtgtcaaattggagggtctgttgtccggacctctggcagtctctatgggggtgccacagggttcaattcttggaccgactctcttctctgtatacatcaatgaggtcgctcttgctgctggtgagtctctgatccacctctacgcagacgacaccattctgtatacttccggcccttctttggacactgtgttaacaaccctccaggcaagcttcaatgccatacaactctccttccgtggcctccaattgctcttaaatacaagtaaaactaaatgcatgctcttcaaccgatcgctacctgcacctacctgcctgtccaacatcactactctggacggctctgacttagaatacgtggacaactacaaatacttaggtgtctggttagactgtaaactctccttccagacccatatcaaacatctccaatccaaagttaaatctagaattggcttccta

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2376118 True 596 TUCP 0.47 1 35827116 35827711
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110507269 NA coding downstream 39419 35783493 ~ 35787697 (-)
LOC110507210 gria4 coding downstream 496499 35169232 ~ 35330617 (-)
LOC110507205 LOC106581390 coding downstream 927708 34898581 ~ 34899408 (-)
LOC110507204 NA coding downstream 932433 34886462 ~ 34894683 (-)
LOC110507202 LOC106581387 coding downstream 957860 34866113 ~ 34869256 (-)
LOC110507979 rab38 coding upstream 248432 36076143 ~ 36107044 (-)
LOC110507212 NA coding upstream 280005 36107716 ~ 36108445 (-)
LOC110507213 LOC106581415 coding upstream 305026 36129462 ~ 36264360 (-)
LOC110508009 nox4 coding upstream 467339 36295050 ~ 36364517 (-)
nlrc3l LOC106581410 coding upstream 568301 36396012 ~ 36426037 (-)
G2078202 NA non-coding downstream 26218 35800659 ~ 35800898 (-)
G2078163 NA non-coding downstream 66915 35759985 ~ 35760201 (-)
G2078156 NA non-coding downstream 72634 35754242 ~ 35754482 (-)
G2078136 NA non-coding downstream 85783 35741089 ~ 35741333 (-)
G2078124 NA non-coding downstream 96394 35730504 ~ 35730722 (-)
G2078220 NA non-coding upstream 1953 35829664 ~ 35829969 (-)
G2078229 NA non-coding upstream 4742 35832453 ~ 35832728 (-)
G2078241 NA non-coding upstream 13797 35841508 ~ 35855235 (-)
G2078242 NA non-coding upstream 17522 35845233 ~ 35850952 (-)
G2078283 NA non-coding upstream 90247 35917958 ~ 35918167 (-)
G2078119 NA other downstream 99634 35726856 ~ 35727482 (-)
G2077936 NA other downstream 390859 35435594 ~ 35436257 (-)
G2077934 NA other downstream 391904 35434874 ~ 35435212 (-)
G2077617 NA other downstream 673073 35116382 ~ 35154043 (-)
G2076236 NA other downstream 2946228 32878789 ~ 32880888 (-)
G2078260 NA other upstream 31191 35858902 ~ 35866253 (-)
G2078263 NA other upstream 45591 35873302 ~ 35876648 (-)
G2078637 NA other upstream 274989 36102700 ~ 36104141 (-)
G2078753 NA other upstream 555474 36383185 ~ 36389384 (-)

Expression


G2078218 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G2078218 Expression in each Bioproject

Bar chart with 20 bars.
G2078218 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network