G2085419



Basic Information


Item Value
gene id G2085419
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048591.1
NCBI id CM023245.2
chromosome length 51556237
location 43294336 ~ 43294588 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2384792
tgtttctggtgtcctttgacagctctttggtcttggccatagtggagtttggagtgtgactgtttgaggttgtggacagttgtcttttatactgataacaagttcaaacaggtgccattaatacaggtaacgagtggaggacagaggagcctcttaaagacgaagttacaggtctgtgagagccagaaatcttgcttgtttgtaggtgaccaaatacttattttccaccataatttgcaaataaattcataaa

Function


NR:

description
unnamed protein product

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU2384792 True 253 lncRNA 0.40 1 43294336 43294588
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118944772 LOC106581517 coding downstream 644435 42647144 ~ 42649901 (-)
LOC110508058 LOC106581494 coding downstream 729756 42561570 ~ 42564580 (-)
neu4 LOC106581489 coding downstream 753996 42516527 ~ 42540340 (-)
aadac LOC106613299 coding downstream 1008791 42262030 ~ 42285545 (-)
LOC110508063 LOC106581498 coding downstream 1187172 41926917 ~ 42107164 (-)
LOC110519585 LOC106581519 coding upstream 1223 43295811 ~ 43529347 (-)
LOC110508094 tnfaip1 coding upstream 240967 43535555 ~ 43549204 (-)
tmem97 tmem97 coding upstream 261988 43556576 ~ 43558533 (-)
LOC110508089 LOC106581526 coding upstream 442482 43737070 ~ 43762876 (-)
LOC110508088 LOC106581525 coding upstream 474652 43769240 ~ 43783275 (-)
G2085389 NA non-coding downstream 50369 43243546 ~ 43243967 (-)
G2085381 NA non-coding downstream 67077 43227039 ~ 43227259 (-)
G2085380 NA non-coding downstream 70461 43222905 ~ 43223875 (-)
G2085374 NA non-coding downstream 82433 43211678 ~ 43211903 (-)
G2085372 NA non-coding downstream 90519 43203554 ~ 43203817 (-)
G2085429 NA non-coding upstream 38321 43332909 ~ 43333353 (-)
G2085438 LOC106581523 non-coding upstream 58079 43352667 ~ 43353955 (-)
G2085444 NA non-coding upstream 77640 43372228 ~ 43375075 (-)
G2085450 NA non-coding upstream 87742 43382330 ~ 43383305 (-)
G2084740 LOC106613316 other downstream 509301 42784627 ~ 42785035 (-)
LOC118944786 LOC106581464 other downstream 1613644 41573411 ~ 41680789 (-)
G2083443 NA other downstream 1870296 41423539 ~ 41424040 (-)
LOC110508045 LOC106581475 other downstream 2319129 40967894 ~ 40977862 (-)
LOC110507273 LOC106581487 other downstream 2413099 40878111 ~ 40883459 (-)
G2085726 NA other upstream 617572 43912160 ~ 43912680 (-)
G2086783 NA other upstream 1626321 44920909 ~ 44921312 (-)
G2087090 LOC106593344 other upstream 2235768 45530356 ~ 45530780 (-)
G2087288 NA other upstream 2502482 45797070 ~ 45798330 (-)
ndufc2 nduc2 other upstream 3677993 46972581 ~ 46975116 (-)

Expression


G2085419 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G2085419 Expression in each Bioproject

Bar chart with 19 bars.
G2085419 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network