trnak-uuu-208



Basic Information


Item Value
gene id trnak-uuu-208
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 35247204 ~ 35247276 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnak-uuu-208
gcccagatagctcagtcggtagagcatcagacttttaatctgagggtccagggttcaagtccctgtttgggcg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnak-uuu-208 True 73 mRNA 0.53 1 35247204 35247276

Neighbor


gene id symbol gene type direction distance location
trnak-uuu-207 NA coding upstream 1232 35245900 ~ 35245972 (+)
trnak-uuu-206 NA coding upstream 2536 35244596 ~ 35244668 (+)
trnak-uuu-205 NA coding upstream 3833 35243299 ~ 35243371 (+)
trnak-uuu-204 NA coding upstream 5128 35242004 ~ 35242076 (+)
trnak-uuu-203 NA coding upstream 6474 35240658 ~ 35240730 (+)
trnak-uuu-209 NA coding downstream 1232 35248508 ~ 35248580 (+)
trnak-uuu-210 NA coding downstream 2527 35249803 ~ 35249875 (+)
trnak-uuu-211 NA coding downstream 3831 35251107 ~ 35251179 (+)
trnak-uuu-212 NA coding downstream 5128 35252404 ~ 35252476 (+)
trnak-uuu-213 NA coding downstream 6425 35253701 ~ 35253773 (+)
G2132004 NA non-coding upstream 5509 35189856 ~ 35241695 (+)
G2132000 NA non-coding upstream 77553 35132427 ~ 35169651 (+)
G2131978 NA non-coding upstream 132040 35114958 ~ 35115164 (+)
G2131973 NA non-coding upstream 136187 35110780 ~ 35111017 (+)
G2131944 LOC106598057 non-coding upstream 146679 35100204 ~ 35100525 (+)
G2132015 NA non-coding downstream 87630 35334906 ~ 35335164 (+)
G2132017 NA non-coding downstream 109148 35356424 ~ 35356694 (+)
G2132031 NA non-coding downstream 148252 35395528 ~ 35395734 (+)
G2132033 NA non-coding downstream 150951 35398227 ~ 35398458 (+)
G2132039 NA non-coding downstream 163393 35410669 ~ 35410875 (+)
G2131933 NA other upstream 154170 35091699 ~ 35093034 (+)
G2131426 NA other upstream 463786 34702206 ~ 34783418 (+)
G2131416 NA other upstream 559564 34687271 ~ 34687640 (+)
G2131383 NA other upstream 642251 34603485 ~ 34604953 (+)
LOC110508236 LOC106598267 other upstream 873194 34352592 ~ 34409491 (+)
G2132291 NA other downstream 452570 35699846 ~ 35700235 (+)
LOC110508289 LOC106597230 other downstream 726163 35973386 ~ 35975132 (+)
G2132519 LOC100380659 other downstream 1091818 36339094 ~ 36364994 (+)
G2132611 LOC100380659 other downstream 1118280 36365556 ~ 36369967 (+)
LOC110509112 LOC106597339 other downstream 1275478 36522754 ~ 36528580 (+)

Expression


trnak-uuu-208 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network