trnak-uuu-211



Basic Information


Item Value
gene id trnak-uuu-211
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 35251107 ~ 35251179 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnak-uuu-211
gcccagatagctcagtcggtagagcatcagacttttaatctgagggtccagggttcaagtccctgtttgggcg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnak-uuu-211 True 73 mRNA 0.53 1 35251107 35251179

Neighbor


gene id symbol gene type direction distance location
trnak-uuu-210 NA coding upstream 1232 35249803 ~ 35249875 (+)
trnak-uuu-209 NA coding upstream 2527 35248508 ~ 35248580 (+)
trnak-uuu-208 NA coding upstream 3831 35247204 ~ 35247276 (+)
trnak-uuu-207 NA coding upstream 5135 35245900 ~ 35245972 (+)
trnak-uuu-206 NA coding upstream 6439 35244596 ~ 35244668 (+)
trnak-uuu-212 NA coding downstream 1225 35252404 ~ 35252476 (+)
trnak-uuu-213 NA coding downstream 2522 35253701 ~ 35253773 (+)
trnak-uuu-214 NA coding downstream 3819 35254998 ~ 35255070 (+)
trnak-uuu-215 NA coding downstream 5123 35256302 ~ 35256374 (+)
trnak-uuu-216 NA coding downstream 7047 35258226 ~ 35258298 (+)
G2132004 NA non-coding upstream 9412 35189856 ~ 35241695 (+)
G2132000 NA non-coding upstream 81456 35132427 ~ 35169651 (+)
G2131978 NA non-coding upstream 135943 35114958 ~ 35115164 (+)
G2131973 NA non-coding upstream 140090 35110780 ~ 35111017 (+)
G2131944 LOC106598057 non-coding upstream 150582 35100204 ~ 35100525 (+)
G2132015 NA non-coding downstream 83727 35334906 ~ 35335164 (+)
G2132017 NA non-coding downstream 105245 35356424 ~ 35356694 (+)
G2132031 NA non-coding downstream 144349 35395528 ~ 35395734 (+)
G2132033 NA non-coding downstream 147048 35398227 ~ 35398458 (+)
G2132039 NA non-coding downstream 159490 35410669 ~ 35410875 (+)
G2131933 NA other upstream 158073 35091699 ~ 35093034 (+)
G2131426 NA other upstream 467689 34702206 ~ 34783418 (+)
G2131416 NA other upstream 563467 34687271 ~ 34687640 (+)
G2131383 NA other upstream 646154 34603485 ~ 34604953 (+)
LOC110508236 LOC106598267 other upstream 877097 34352592 ~ 34409491 (+)
G2132291 NA other downstream 448667 35699846 ~ 35700235 (+)
LOC110508289 LOC106597230 other downstream 722260 35973386 ~ 35975132 (+)
G2132519 LOC100380659 other downstream 1087915 36339094 ~ 36364994 (+)
G2132611 LOC100380659 other downstream 1114377 36365556 ~ 36369967 (+)
LOC110509112 LOC106597339 other downstream 1271575 36522754 ~ 36528580 (+)

Expression


trnak-uuu-211 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network