trnak-uuu-237



Basic Information


Item Value
gene id trnak-uuu-237
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 35289886 ~ 35289958 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnak-uuu-237
gcccagatagctcagtcggtagagcatcagacttttaatctgagggtccagggttcaagtccctgtttgggcg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnak-uuu-237 True 73 mRNA 0.53 1 35289886 35289958

Neighbor


gene id symbol gene type direction distance location
trnak-uuu-236 NA coding upstream 2533 35287281 ~ 35287353 (+)
trnak-uuu-235 NA coding upstream 4095 35285719 ~ 35285791 (+)
trnak-uuu-234 NA coding upstream 5392 35284422 ~ 35284494 (+)
trnak-uuu-233 NA coding upstream 6950 35282864 ~ 35282936 (+)
trnak-uuu-232 NA coding upstream 8506 35281308 ~ 35281380 (+)
trnak-uuu-238 NA coding downstream 2531 35292489 ~ 35292561 (+)
trnak-uuu-239 NA coding downstream 4090 35294048 ~ 35294120 (+)
trnak-uuu-240 NA coding downstream 6692 35296650 ~ 35296722 (+)
trnak-uuu-241 NA coding downstream 8251 35298209 ~ 35298281 (+)
trnak-uuu-242 NA coding downstream 9810 35299768 ~ 35299840 (+)
G2132004 NA non-coding upstream 48191 35189856 ~ 35241695 (+)
G2132000 NA non-coding upstream 120235 35132427 ~ 35169651 (+)
G2131978 NA non-coding upstream 174722 35114958 ~ 35115164 (+)
G2131973 NA non-coding upstream 178869 35110780 ~ 35111017 (+)
G2131944 LOC106598057 non-coding upstream 189361 35100204 ~ 35100525 (+)
G2132015 NA non-coding downstream 44948 35334906 ~ 35335164 (+)
G2132017 NA non-coding downstream 66466 35356424 ~ 35356694 (+)
G2132031 NA non-coding downstream 105570 35395528 ~ 35395734 (+)
G2132033 NA non-coding downstream 108269 35398227 ~ 35398458 (+)
G2132039 NA non-coding downstream 120711 35410669 ~ 35410875 (+)
G2131933 NA other upstream 196852 35091699 ~ 35093034 (+)
G2131426 NA other upstream 506468 34702206 ~ 34783418 (+)
G2131416 NA other upstream 602246 34687271 ~ 34687640 (+)
G2131383 NA other upstream 684933 34603485 ~ 34604953 (+)
LOC110508236 LOC106598267 other upstream 915876 34352592 ~ 34409491 (+)
G2132291 NA other downstream 409888 35699846 ~ 35700235 (+)
LOC110508289 LOC106597230 other downstream 683481 35973386 ~ 35975132 (+)
G2132519 LOC100380659 other downstream 1049136 36339094 ~ 36364994 (+)
G2132611 LOC100380659 other downstream 1075598 36365556 ~ 36369967 (+)
LOC110509112 LOC106597339 other downstream 1232796 36522754 ~ 36528580 (+)

Expression


trnak-uuu-237 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network