trnak-uuu-242



Basic Information


Item Value
gene id trnak-uuu-242
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 35299768 ~ 35299840 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnak-uuu-242
gcccagatagctcagtcggtagagcatcagacttttaatctgagggtccagggttcaagtccctgtttgggcg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnak-uuu-242 True 73 mRNA 0.53 1 35299768 35299840
Loading

Neighbor


gene id symbol gene type direction distance location
trnak-uuu-241 NA coding upstream 1487 35298209 ~ 35298281 (+)
trnak-uuu-240 NA coding upstream 3046 35296650 ~ 35296722 (+)
trnak-uuu-239 NA coding upstream 5648 35294048 ~ 35294120 (+)
trnak-uuu-238 NA coding upstream 7207 35292489 ~ 35292561 (+)
trnak-uuu-237 NA coding upstream 9810 35289886 ~ 35289958 (+)
trnak-uuu-243 NA coding downstream 1487 35301327 ~ 35301399 (+)
trnak-uuu-244 NA coding downstream 3046 35302886 ~ 35302958 (+)
trnak-uuu-245 NA coding downstream 4608 35304448 ~ 35304520 (+)
trnak-uuu-246 NA coding downstream 6167 35306007 ~ 35306079 (+)
trnak-uuu-247 NA coding downstream 7729 35307569 ~ 35307641 (+)
G2132005 NA non-coding upstream 6012 35245289 ~ 35293756 (+)
G2132004 NA non-coding upstream 58073 35189856 ~ 35241695 (+)
G2132000 NA non-coding upstream 130117 35132427 ~ 35169651 (+)
G2131978 NA non-coding upstream 184604 35114958 ~ 35115164 (+)
G2131973 NA non-coding upstream 188751 35110780 ~ 35111017 (+)
G2132015 NA non-coding downstream 35066 35334906 ~ 35335164 (+)
G2132017 NA non-coding downstream 56584 35356424 ~ 35356694 (+)
G2132031 NA non-coding downstream 95688 35395528 ~ 35395734 (+)
G2132033 NA non-coding downstream 98387 35398227 ~ 35398458 (+)
G2132039 NA non-coding downstream 110829 35410669 ~ 35410875 (+)
G2131933 NA other upstream 206734 35091699 ~ 35093034 (+)
G2131426 NA other upstream 516350 34702206 ~ 34783418 (+)
G2131416 NA other upstream 612128 34687271 ~ 34687640 (+)
G2131383 NA other upstream 694815 34603485 ~ 34604953 (+)
LOC110508236 LOC106598267 other upstream 925758 34352592 ~ 34409491 (+)
G2132291 NA other downstream 400006 35699846 ~ 35700235 (+)
LOC110508289 LOC106597230 other downstream 673599 35973386 ~ 35975132 (+)
G2132519 LOC100380659 other downstream 1039254 36339094 ~ 36364994 (+)
G2132611 LOC100380659 other downstream 1065716 36365556 ~ 36369967 (+)
LOC110509112 LOC106597339 other downstream 1222914 36522754 ~ 36528580 (+)

Expression


trnak-uuu-242 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network