G2092886



Basic Information


Item Value
gene id G2092886
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 334529 ~ 334939 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2394131
agtctgcaaggagccgccagagctgtcagtctgcaaggagccgccagtcagcatggagccgccagagccgccagtcagcatggagccgccagagccgccagtcagcatggagcagccagagccgccagtcagcatggagcagccagagccgccagtcagcatggagcagccagagccgccagtcagcatggagcagccagagccaccagtcagcatggagcagccagagcc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2394131 True 231 TUCP 0.66 2 334529 334939

Neighbor


gene id symbol gene type direction distance location
LOC110508302 LOC106587021 coding downstream 104937 181782 ~ 229592 (-)
LOC110508306 LOC106600515 coding upstream 220748 555687 ~ 583424 (-)
LOC110508312 sppl2b coding upstream 562650 897589 ~ 947373 (-)
LOC118944809 NA coding upstream 653846 988785 ~ 991348 (-)
phc3 phc3 coding upstream 670949 1005888 ~ 1029028 (-)
LOC110508204 LOC106600525 coding upstream 870836 1205775 ~ 1208298 (-)
G2092823 NA non-coding downstream 73119 255632 ~ 261410 (-)
G2092780 LOC106600517 non-coding downstream 176631 155205 ~ 157898 (-)
G2092770 NA non-coding downstream 195622 138593 ~ 138907 (-)
G2092767 NA non-coding downstream 200621 133629 ~ 133908 (-)
G2092755 NA non-coding downstream 208359 125968 ~ 126170 (-)
G2092999 NA non-coding upstream 132489 467428 ~ 468720 (-)
G2093021 NA non-coding upstream 181226 516165 ~ 516503 (-)
G2093023 NA non-coding upstream 183488 518427 ~ 518709 (-)
G2093142 NA non-coding upstream 369095 704034 ~ 706471 (-)
G2093433 NA other upstream 700489 1035428 ~ 1035674 (-)
G2093581 LOC106600502 other upstream 821095 1156034 ~ 1164637 (-)
LOC110508327 lig1 other upstream 1368874 1703128 ~ 1742400 (-)
G2094433 LOC106600477 other upstream 1571968 1906907 ~ 1907412 (-)

Expression


G2092886 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G2092886 Expression in each Bioproject

Bar chart with 16 bars.
G2092886 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network