G2093424



Basic Information


Item Value
gene id G2093424
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 1015381 ~ 1015763 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2394710
tgtcaaattggtgatgttcaaaaatagttttattttatttttttaaacagttacagatccagttgcagcgtgttcatacaaatctttttaaagtgtgcttcggagcactgcgagatttctgtgattttctgaaataacacacactcactaaaccctccgtaaataagtcagttcttaacataaagacttaaaactcaaaattctataattgcctaccccaaggaggatatgtgttcactttcagcttcctgtgtaaaccggaagtgccttaaaatggtgtcataggtgctgtttcgaagggttaaaaaggtcagatcttttcaaaacttcatatgtgtgattaagcaacccccatgaactgtaagtcagtcatttctcccaac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2394710 True 383 lncRNA 0.36 1 1015381 1015763
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118944809 NA coding downstream 24033 988785 ~ 991348 (-)
LOC110508312 sppl2b coding downstream 68008 897589 ~ 947373 (-)
LOC110508306 LOC106600515 coding downstream 431957 555687 ~ 583424 (-)
LOC110508302 LOC106587021 coding downstream 785789 181782 ~ 229592 (-)
LOC110508204 LOC106600525 coding upstream 190012 1205775 ~ 1208298 (-)
LOC110508319 LOC106600498 coding upstream 332001 1347764 ~ 1353801 (-)
LOC110508320 NA coding upstream 377503 1393266 ~ 1394586 (-)
LOC110508322 LOC106600495 coding upstream 442449 1458212 ~ 1562320 (-)
LOC110509191 LOC106600493 coding upstream 555727 1571490 ~ 1640448 (-)
G2093316 NA non-coding downstream 58018 957065 ~ 957363 (-)
G2093310 lsm7 non-coding downstream 61058 952931 ~ 954323 (-)
G2093247 NA non-coding downstream 91057 861441 ~ 924324 (-)
G2093245 NA non-coding downstream 102930 858962 ~ 912451 (-)
G2093257 NA non-coding downstream 143175 871804 ~ 872206 (-)
G2093490 NA non-coding upstream 89639 1105402 ~ 1107594 (-)
G2093491 NA non-coding upstream 92439 1108202 ~ 1108464 (-)
G2093504 NA non-coding upstream 102813 1118576 ~ 1118819 (-)
G2093509 NA non-coding upstream 107056 1122819 ~ 1123057 (-)
G2093510 NA non-coding upstream 108278 1124041 ~ 1124371 (-)
G2092886 NA other downstream 680442 334529 ~ 334939 (-)
G2093433 NA other upstream 19665 1035428 ~ 1035674 (-)
G2093581 LOC106600502 other upstream 140271 1156034 ~ 1164637 (-)
LOC110508327 lig1 other upstream 688050 1703128 ~ 1742400 (-)
G2094433 LOC106600477 other upstream 891144 1906907 ~ 1907412 (-)
G2096163 NA other upstream 2293381 3309144 ~ 3309674 (-)

Expression


G2093424 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G2093424 Expression in each Bioproject

Bar chart with 20 bars.
G2093424 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network