G2094913



Basic Information


Item Value
gene id G2094913
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 2691842 ~ 2692078 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2396326
gtgaaaatgttgcctgctgaatgctaggcttaatgctatgctaggctatcaatactcttacacaaatgcttgtgtagctttggttaaagtatattttgaaaatctgagatgacagtgttgttaacaaaaggctaagcttgtgtttcaatatatttatttcatttaatttgcgattttcatgaataggaaacgttgcgttatggtaatgagcttgaggctatgattacgctcccggat

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2396326 True 237 lncRNA 0.35 1 2691842 2692078

Neighbor


gene id symbol gene type direction distance location
LOC110508345 LOC106569642 coding upstream 26691 2661880 ~ 2665151 (+)
LOC110508342 LOC106600594 coding upstream 63277 2522834 ~ 2628565 (+)
LOC118944816 NA coding upstream 183724 2496729 ~ 2508118 (+)
LOC110508340 LOC106600596 coding upstream 208646 2477758 ~ 2483196 (+)
LOC110508337 scg2 coding upstream 227707 2459632 ~ 2464135 (+)
LOC110509193 LOC106600589 coding downstream 42493 2734571 ~ 2810333 (+)
LOC118944856 NA coding downstream 56854 2748932 ~ 2752891 (+)
LOC110508347 LOC106600588 coding downstream 145084 2837162 ~ 2892104 (+)
yeats2 yeats2 coding downstream 208706 2900784 ~ 2969598 (+)
alg3 alg3 coding downstream 634336 3326414 ~ 3335014 (+)
G2094911 NA non-coding upstream 1849 2689714 ~ 2689993 (+)
G2094903 NA non-coding upstream 12461 2679142 ~ 2679381 (+)
G2094900 NA non-coding upstream 12753 2674863 ~ 2679089 (+)
G2094894 NA non-coding upstream 21451 2670168 ~ 2670391 (+)
G2094883 NA non-coding upstream 38089 2653312 ~ 2653753 (+)
G2095340 NA non-coding downstream 120270 2812348 ~ 2814408 (+)
G2095424 NA non-coding downstream 177619 2869697 ~ 2869921 (+)
G2095426 NA non-coding downstream 179572 2871650 ~ 2871903 (+)
G2095431 NA non-coding downstream 187346 2879424 ~ 2879757 (+)
G2095432 NA non-coding downstream 188552 2880630 ~ 2880846 (+)
G2094884 NA other upstream 36751 2653863 ~ 2655091 (+)
LOC110509192 LOC106600604 other upstream 508224 2094076 ~ 2190557 (+)
G2093960 mpz other upstream 997373 1684106 ~ 1696486 (+)
G2093889 NA other upstream 1245721 1444633 ~ 1446121 (+)
G2092558 NA other upstream 1997184 694133 ~ 694658 (+)
G2095895 LOC106600579 other downstream 649106 3341184 ~ 3341519 (+)
G2096475 NA other downstream 1195302 3887380 ~ 3907871 (+)
G2096472 NA other downstream 1207508 3899586 ~ 3917985 (+)
G2097031 NA other downstream 1843998 4536076 ~ 4536894 (+)

Expression


G2094913 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G2094913 Expression in each Bioproject

Bar chart with 19 bars.
G2094913 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network