G2098135



Basic Information


Item Value
gene id G2098135
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 5498188 ~ 5498514 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2399956
ATTGAGAATAAATAGGGGGAGATAAAACATGGTCCTTTGAGGTTTGGACAGGACACCGTATTAAACCAATAGTGCAGGAAATTACATAGAAAAATAAGTTTCAGTTCTTAGAGGTGATAAATTACTGTAGATAAGGCATTCCACACACTATGCAACATATATTAAATTATTGATGAAACTGATTTTAAGGTTAATTCATGTTATTGTCAGATAAAATACTGTGGATCCCTGAAGGAAAAAGGTTATTAGTGTAGGAAGGATTTGATATATTTAGCATTCATTTTGGCTTTGTTTGACTATTAGGAGGTTTTTATTTAAATAGTATTA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2399956 True 327 lncRNA 0.31 1 5498188 5498514
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110508385 LOC106600542 coding upstream 1692 5392397 ~ 5496496 (+)
LOC110508384 LOC106600544 coding upstream 124284 5271069 ~ 5377935 (+)
LOC110508382 LOC106600607 coding upstream 385382 5106652 ~ 5112806 (+)
LOC110485777 LOC106612417 coding upstream 625698 4869225 ~ 4872490 (+)
slc17a9b LOC106600547 coding upstream 784558 4682499 ~ 4714289 (+)
LOC110509204 prpf6 coding downstream 625260 6123728 ~ 6157102 (+)
LOC110508396 LOC106600623 coding downstream 786631 6285145 ~ 6341018 (+)
zfp313 zfp313 coding downstream 882604 6381000 ~ 6389696 (+)
LOC110508401 LOC106600630 coding downstream 1024868 6523039 ~ 6628031 (+)
LOC110508406 LOC106599979 coding downstream 1328074 6826588 ~ 6831152 (+)
G2098123 NA non-coding upstream 56723 5441102 ~ 5441465 (+)
G2098115 NA non-coding upstream 99177 5396585 ~ 5399011 (+)
G2098109 NA non-coding upstream 108711 5389252 ~ 5389477 (+)
G2098105 NA non-coding upstream 114727 5383256 ~ 5383461 (+)
G2098140 NA non-coding downstream 3449 5501963 ~ 5502162 (+)
G2098141 NA non-coding downstream 3822 5502336 ~ 5502541 (+)
G2098142 NA non-coding downstream 4726 5503240 ~ 5503499 (+)
G2098143 NA non-coding downstream 5394 5503908 ~ 5504509 (+)
G2098201 NA non-coding downstream 131976 5630490 ~ 5639479 (+)
G2097031 NA other upstream 961294 4536076 ~ 4536894 (+)
G2096472 NA other upstream 1580203 3899586 ~ 3917985 (+)
G2096475 NA other upstream 1590317 3887380 ~ 3907871 (+)
G2095895 LOC106600579 other upstream 2156669 3341184 ~ 3341519 (+)
G2098625 NA other downstream 470047 5968561 ~ 5998314 (+)
G2098849 NA other downstream 591214 6089728 ~ 6090062 (+)

Expression


G2098135 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G2098135 Expression in each Bioproject

Bar chart with 14 bars.
G2098135 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 12.
End of interactive chart.

Co-expression Network