G2099517



Basic Information


Item Value
gene id G2099517
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 6748912 ~ 6749140 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2401511
cctttaatcccagaaaaatggccataactcaaaaaccgtcgaggcctagacgccatcttgttcggggccaactgcccattatgccaaacctacgctcaccaagtttcggcttcgaaatattttccgttttcgagataaggccccgtcgtgattcgtgatgttttgccaaattgccatatgattccgtatgccctcttgtgggaatttccgggatagcggaaaaacggtc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2401511 True 229 lncRNA 0.48 1 6748912 6749140
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110508401 LOC106600630 coding upstream 180346 6523039 ~ 6628031 (+)
zfp313 zfp313 coding upstream 359216 6381000 ~ 6389696 (+)
LOC110508396 LOC106600623 coding upstream 407953 6285145 ~ 6341018 (+)
LOC110509204 prpf6 coding upstream 593505 6123728 ~ 6157102 (+)
LOC110508385 LOC106600542 coding upstream 1252416 5392397 ~ 5496496 (+)
LOC110508406 LOC106599979 coding downstream 77448 6826588 ~ 6831152 (+)
LOC110508407 LOC106599981 coding downstream 85117 6834257 ~ 6891325 (+)
LOC110508408 LOC106569542 coding downstream 199288 6948428 ~ 6962016 (+)
LOC110508411 LOC106599988 coding downstream 280904 7030044 ~ 7039045 (+)
LOC110508413 LOC106599990 coding downstream 391013 7140153 ~ 7200444 (+)
G2099514 NA non-coding upstream 5451 6742714 ~ 6743461 (+)
G2099499 NA non-coding upstream 21885 6726353 ~ 6727027 (+)
G2099493 NA non-coding upstream 31112 6717502 ~ 6717800 (+)
G2099491 NA non-coding upstream 32281 6716394 ~ 6716631 (+)
G2099489 NA non-coding upstream 35699 6712952 ~ 6713213 (+)
G2099547 NA non-coding downstream 53767 6802907 ~ 6803289 (+)
G2099556 NA non-coding downstream 66936 6816076 ~ 6816295 (+)
G2099589 NA non-coding downstream 116844 6865984 ~ 6866218 (+)
G2099590 NA non-coding downstream 119148 6868288 ~ 6868513 (+)
G2099592 NA non-coding downstream 120873 6870013 ~ 6870268 (+)
G2099116 LOC106600629 other upstream 319975 6427205 ~ 6428937 (+)
G2100344 LOC107579696 other downstream 678431 7427571 ~ 7428415 (+)
G2100382 LOC106600009 other downstream 790049 7539189 ~ 7564546 (+)
G2101665 NA other downstream 1878832 8627972 ~ 8632449 (+)
G2102205 NA other downstream 2441821 9190961 ~ 9246215 (+)

Expression


G2099517 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G2099517 Expression in each Bioproject

Bar chart with 17 bars.
G2099517 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network