G2106000



Basic Information


Item Value
gene id G2106000
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 12482876 ~ 12483108 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2408746
ATCCTGCAGTTCAAATAAATGTTGCTCGTTGTTTTGTAAGAGGTCACATGTACCGCAAATTCACTTAGAAGGGTACCATTTCTGTACTTGCCTTAAGCATAAGAAGAGAACGAAGGCCACGACAAGAGCTCCCACAGAAATACAGTGGCCTAGGTAGTTGATGATCAGAGCAATCTTATAGTGCATTGGGTATTTCCTCTGAGGAGAGAATATCACAAGTTCTGCTTCAAAAT

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2408746 True 233 lncRNA 0.41 1 12482876 12483108
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110508565 LOC106600435 coding downstream 234367 12245790 ~ 12248509 (-)
thoc1 LOC106600433 coding downstream 251974 12222094 ~ 12230902 (-)
LOC110508560 LOC106600431 coding downstream 353046 12019354 ~ 12129830 (-)
mib1 LOC106600429 coding downstream 488062 11906126 ~ 11994814 (-)
gata6 LOC106600428 coding downstream 639069 11836647 ~ 11843807 (-)
myl13 LOC100194663 coding upstream 27572 12510680 ~ 12515518 (-)
LOC110508569 LOC106569331 coding upstream 155403 12638511 ~ 12666401 (-)
ccdc13 ccdc13 coding upstream 194716 12677824 ~ 12688016 (-)
LOC110508576 LOC106599876 coding upstream 262911 12746019 ~ 12750292 (-)
LOC110508577 LOC106599874 coding upstream 451129 12934237 ~ 12968139 (-)
G2105867 NA non-coding downstream 197605 12270367 ~ 12285271 (-)
G2105774 NA non-coding downstream 368583 12114026 ~ 12114293 (-)
G2105773 LOC106600457 non-coding downstream 370384 12112258 ~ 12112492 (-)
G2105769 NA non-coding downstream 377612 12105038 ~ 12105264 (-)
G2106001 NA non-coding upstream 579 12483687 ~ 12484085 (-)
G2106002 NA non-coding upstream 1141 12484249 ~ 12484454 (-)
G2106003 NA non-coding upstream 1805 12484913 ~ 12485205 (-)
G2106005 NA non-coding upstream 3911 12487019 ~ 12487258 (-)
G2106006 NA non-coding upstream 4876 12487984 ~ 12488256 (-)
G2105419 LOC104953893 other downstream 982804 11499126 ~ 11500072 (-)
LOC110508522 NA other downstream 1588796 10886198 ~ 10894141 (-)
G2103920 NA other downstream 1774377 10708012 ~ 10708499 (-)
G2103257 NA other downstream 2276200 10206063 ~ 10206676 (-)
G2103203 LOC106600278 other downstream 2367479 10113428 ~ 10115397 (-)
G2109663 LOC106599735 other upstream 3056660 15539768 ~ 15554897 (-)
G2109705 NA other upstream 3120577 15603685 ~ 15604463 (-)
LOC110508627 LOC106599725 other upstream 3220228 15703333 ~ 15793545 (-)
G2110939 NA other upstream 4316282 16799390 ~ 16799869 (-)
LOC110508646 LOC106599672 other upstream 4773100 17254319 ~ 17260420 (-)

Expression


G2106000 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G2106000 Expression in each Bioproject

Bar chart with 3 bars.
G2106000 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 14.
End of interactive chart.

Co-expression Network