G2106543



Basic Information


Item Value
gene id G2106543
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 13126962 ~ 13127231 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2409335
TGGTAAATTGAGATTAATGGAGCTTTCTGCCTCGTCTGAGGCTACACAGGTGTACACTCCCTGGTCAGCAGACTCAAAGTCTTTGATCAGCAGCACTTGTGTCTTGCCCTCGATGGTGACCTGGTATTTGACCCCAAACTCCAGCTCCTTGTTGTCTCTGAGCCAGGTGACCGAGCTGCCCTCAGCAGAGAGCTGGCACTCTACACGGGCCATCTTACCCTCCTGCAAGCCTGGACAGGCCAACTGCTGGATCACTGTGATCGGAGCCTC

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2409335 True 270 TUCP 0.54 1 13126962 13127231

Neighbor


gene id symbol gene type direction distance location
LOC110508581 kgua coding upstream 24631 13080598 ~ 13102331 (+)
LOC110508579 arf1 coding upstream 61255 13060580 ~ 13065707 (+)
LOC110508578 LOC106599872 coding upstream 116585 12981805 ~ 13010377 (+)
LOC110508574 LOC106599880 coding upstream 370576 12749686 ~ 12756386 (+)
LOC110508573 LOC106599884 coding upstream 393422 12706958 ~ 12733540 (+)
LOC100136204 LOC100136204 coding downstream 90766 13217997 ~ 13219450 (+)
LOC118944853 LOC100136204 coding downstream 98162 13225393 ~ 13226868 (+)
LOC110508587 LOC106599852 coding downstream 134898 13262129 ~ 13268809 (+)
LOC118944822 NA coding downstream 137977 13265208 ~ 13266471 (+)
LOC110508586 LOC106599847 coding downstream 142907 13270138 ~ 13284487 (+)
G2106542 NA non-coding upstream 422 13125205 ~ 13126540 (+)
G2106530 NA non-coding upstream 14528 13111499 ~ 13112434 (+)
G2106529 NA non-coding upstream 15718 13110738 ~ 13111244 (+)
G2106445 NA non-coding upstream 156672 12969709 ~ 12970290 (+)
G2106368 NA non-coding upstream 168204 12958474 ~ 12958758 (+)
G2106544 NA non-coding downstream 251 13127482 ~ 13127925 (+)
G2106547 NA non-coding downstream 5741 13132972 ~ 13133341 (+)
G2106551 NA non-coding downstream 9965 13137196 ~ 13137596 (+)
G2106552 LOC106599860 non-coding downstream 10400 13137631 ~ 13138106 (+)
G2106555 LOC106599860 non-coding downstream 12146 13139377 ~ 13140267 (+)
G2106278 NA other upstream 282058 12844387 ~ 12844904 (+)
G2104555 NA other upstream 1193870 11889116 ~ 11933092 (+)
LOC110508540 LOC106600420 other upstream 1636127 11488248 ~ 11491159 (+)
G2103533 LOC105021892 other upstream 2374002 10713576 ~ 10752960 (+)
G2103519 NA other upstream 2423942 10702728 ~ 10703020 (+)
G2106548 NA other downstream 6168 13133399 ~ 13133761 (+)
G2106549 NA other downstream 6663 13133894 ~ 13134485 (+)
G2106557 NA other downstream 16082 13143313 ~ 13143595 (+)
G2107033 NA other downstream 784196 13911427 ~ 13913227 (+)
G2109948 NA other downstream 2811280 15938511 ~ 15938857 (+)

Expression


G2106543 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.8.
End of interactive chart.

G2106543 Expression in each Bioproject

Bar chart with 1 bar.
G2106543 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1.5.
End of interactive chart.

Co-expression Network