G2106557



Basic Information


Item Value
gene id G2106557
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 13143313 ~ 13143595 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2409352
TTTGGCCCCTTACCTCGGACGGTCAGGCTTGCGGTGGAGGTATGGTGACCCACGGTGAAGGTGACTGTGCCCGAGTCGGCCTGGGTGACCCCCCTGAGGGTGAGGCTGTGCACCTTGCCCTGGGCACGGATCAGGTTCATTTCATTGTTCTGCAGAGGGACGTCCGCAAGCTTCCACTGGACCTCCCTGGCGTCATCGTGGGACAGATGGCACTCAAAGTGGACATCCTCCCCCTCGTGCACCGAACAGCTGTTCAAGACCTTCACTATGGTCACCTCCACCT

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2409352 True 283 TUCP 0.60 1 13143313 13143595

Neighbor


gene id symbol gene type direction distance location
LOC110508581 kgua coding upstream 40982 13080598 ~ 13102331 (+)
LOC110508579 arf1 coding upstream 77606 13060580 ~ 13065707 (+)
LOC110508578 LOC106599872 coding upstream 132936 12981805 ~ 13010377 (+)
LOC110508574 LOC106599880 coding upstream 386927 12749686 ~ 12756386 (+)
LOC110508573 LOC106599884 coding upstream 409773 12706958 ~ 12733540 (+)
LOC100136204 LOC100136204 coding downstream 74402 13217997 ~ 13219450 (+)
LOC118944853 LOC100136204 coding downstream 81798 13225393 ~ 13226868 (+)
LOC110508587 LOC106599852 coding downstream 118534 13262129 ~ 13268809 (+)
LOC118944822 NA coding downstream 121613 13265208 ~ 13266471 (+)
LOC110508586 LOC106599847 coding downstream 126543 13270138 ~ 13284487 (+)
G2106555 LOC106599860 non-coding upstream 3046 13139377 ~ 13140267 (+)
G2106552 LOC106599860 non-coding upstream 5207 13137631 ~ 13138106 (+)
G2106551 NA non-coding upstream 5717 13137196 ~ 13137596 (+)
G2106547 NA non-coding upstream 9972 13132972 ~ 13133341 (+)
G2106544 NA non-coding upstream 15388 13127482 ~ 13127925 (+)
G2106558 NA non-coding downstream 11002 13154597 ~ 13160762 (+)
G2106569 NA non-coding downstream 22137 13165732 ~ 13166094 (+)
G2106570 NA non-coding downstream 22558 13166153 ~ 13166988 (+)
G2106571 NA non-coding downstream 23507 13167102 ~ 13167385 (+)
G2106572 NA non-coding downstream 23889 13167484 ~ 13167746 (+)
G2106549 NA other upstream 8828 13133894 ~ 13134485 (+)
G2106548 NA other upstream 9552 13133399 ~ 13133761 (+)
G2106543 NA other upstream 16082 13126962 ~ 13127231 (+)
G2106278 NA other upstream 298409 12844387 ~ 12844904 (+)
G2104555 NA other upstream 1210221 11889116 ~ 11933092 (+)
G2107033 NA other downstream 767832 13911427 ~ 13913227 (+)
G2109948 NA other downstream 2794916 15938511 ~ 15938857 (+)
G2109955 LOC106599720 other downstream 2804713 15948308 ~ 15948861 (+)
G2110507 LOC107717027 other downstream 3304517 16448112 ~ 16448502 (+)
LOC110508278 LOC106599701 other downstream 3668999 16809471 ~ 16813125 (+)

Expression


G2106557 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.25.
End of interactive chart.

G2106557 Expression in each Bioproject

Bar chart with 3 bars.
G2106557 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1.5.
End of interactive chart.

Co-expression Network