G2109409



Basic Information


Item Value
gene id G2109409
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 15612760 ~ 15683031 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2412483
atatacagtgccttgcgaaagtattcggcccccttgaactttgcgaccttttgccacatttcaggcttcaaacaaagatataacactgtatttttttgtgaagaatcaacaacaagtgggacacaatcatgaagtggaacgacatttattggatatttcaaacttttttaacaaatcaaaaactgaaaaattgggcgtgcaaaatgattc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2412483 True 210 lncRNA 0.36 2 15612760 15683031
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110508625 LOC106599735 coding upstream 72095 15519330 ~ 15540665 (+)
LOC118944875 NA coding upstream 260712 15351371 ~ 15352048 (+)
LOC110508620 LOC106599743 coding upstream 587768 14984792 ~ 15024992 (+)
LOC110508619 LOC106599747 coding upstream 653887 14955823 ~ 14958873 (+)
LOC110508615 NA coding upstream 663708 14946004 ~ 14949052 (+)
LOC110508628 LOC106599723 coding downstream 110778 15793809 ~ 15801356 (+)
LOC110508629 LOC106599721 coding downstream 148133 15831164 ~ 15896168 (+)
LOC110508631 igfbp-1b2 coding downstream 217624 15900655 ~ 15903661 (+)
LOC110508635 LOC106599714 coding downstream 390519 16073550 ~ 16132563 (+)
LOC110508636 tbb2a coding downstream 450477 16133508 ~ 16139752 (+)
G2109404 NA non-coding upstream 5363 15606916 ~ 15607397 (+)
G2109403 NA non-coding upstream 6631 15605555 ~ 15606129 (+)
G2109402 NA non-coding upstream 7660 15604649 ~ 15605100 (+)
G2109401 NA non-coding upstream 8514 15604019 ~ 15604246 (+)
G2109400 NA non-coding upstream 11273 15601187 ~ 15601487 (+)
G2109424 NA non-coding downstream 20321 15703352 ~ 15706552 (+)
G2109859 NA non-coding downstream 170985 15854016 ~ 15860341 (+)
G2109932 NA non-coding downstream 214369 15897400 ~ 15898275 (+)
G2109945 NA non-coding downstream 251231 15934262 ~ 15936929 (+)
G2107033 NA other upstream 1699533 13911427 ~ 13913227 (+)
G2106557 NA other upstream 2469165 13143313 ~ 13143595 (+)
G2106549 NA other upstream 2478275 13133894 ~ 13134485 (+)
G2106548 NA other upstream 2478999 13133399 ~ 13133761 (+)
G2106543 NA other upstream 2485529 13126962 ~ 13127231 (+)
G2109948 NA other downstream 255480 15938511 ~ 15938857 (+)
G2109955 LOC106599720 other downstream 265277 15948308 ~ 15948861 (+)
G2110507 LOC107717027 other downstream 765081 16448112 ~ 16448502 (+)
LOC110508278 LOC106599701 other downstream 1129563 16809471 ~ 16813125 (+)
G2111044 NA other downstream 1270753 16953784 ~ 16958852 (+)

Expression


G2109409 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G2109409 Expression in each Bioproject

Bar chart with 7 bars.
G2109409 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network