G2112996



Basic Information


Item Value
gene id G2112996
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 18570906 ~ 18571180 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2416344
ctacaatggaatggttcaaaaataaacatatccaggtgttagaatggccaagtcaaagtccagacctgaatccaatcgagaatctgtggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgagctcgagctgttttgcaaggaggaatgggaaaaaaattcagtctctcgatgtgcaaaactgatagacatactccaagcgacttacagctgtaatcgcagcaaaaggtggcgctacaaagtattaacttaagggggc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2416344 True 275 lncRNA 0.43 1 18570906 18571180
Loading

Neighbor


gene id symbol gene type direction distance location
LOC100136150 LOC105009935 coding upstream 150899 18406183 ~ 18420007 (+)
LOC110508663 LOC106599269 coding upstream 200022 18366089 ~ 18370884 (+)
LOC110508661 LOC106599266 coding upstream 216163 18316616 ~ 18354743 (+)
gs04 gs04 coding upstream 342516 18225312 ~ 18228390 (+)
LOC110508657 LOC106599258 coding upstream 584039 17867728 ~ 17986867 (+)
LOC110508667 LOC106599281 coding downstream 8283 18579463 ~ 18658560 (+)
LOC110508668 LOC106599284 coding downstream 102122 18673302 ~ 18724171 (+)
LOC110508669 LOC106599285 coding downstream 155074 18726254 ~ 18816586 (+)
LOC110508672 NA coding downstream 278006 18849186 ~ 18865414 (+)
LOC110508675 LOC106599295 coding downstream 415517 18986697 ~ 19011641 (+)
G2112979 NA non-coding upstream 9316 18561307 ~ 18561590 (+)
G2112976 NA non-coding upstream 12064 18558622 ~ 18558842 (+)
G2112974 NA non-coding upstream 13097 18557598 ~ 18557809 (+)
G2112964 NA non-coding upstream 18667 18551941 ~ 18552239 (+)
G2112960 NA non-coding upstream 24155 18546522 ~ 18546751 (+)
G2113037 NA non-coding downstream 31607 18602787 ~ 18627157 (+)
G2113081 NA non-coding downstream 132504 18703684 ~ 18703950 (+)
G2113088 NA non-coding downstream 169068 18740248 ~ 18740739 (+)
G2113017 NA non-coding downstream 197659 18768839 ~ 18769063 (+)
G2113089 NA non-coding downstream 207310 18778490 ~ 18778729 (+)
G2112127 NA other upstream 666982 17903198 ~ 17903924 (+)
G2111491 NA other upstream 815325 17754937 ~ 17755581 (+)
G2111457 NA other upstream 862277 17708256 ~ 17708629 (+)
G2111300 NA other upstream 1154674 17411144 ~ 17416232 (+)
G2111044 NA other upstream 1612054 16953784 ~ 16958852 (+)
G2113059 NA other downstream 95935 18667115 ~ 18668496 (+)
G2113578 NA other downstream 504897 19076077 ~ 19076418 (+)
LOC110508695 LOC106599333 other downstream 1052288 19623468 ~ 19636825 (+)
G2115369 NA other downstream 1870553 20441733 ~ 20442169 (+)
LOC110508722 LOC106569260 other downstream 2269390 20840508 ~ 20842019 (+)

Expression


G2112996 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G2112996 Expression in each Bioproject

Bar chart with 17 bars.
G2112996 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network