G2113729 (LOC106581475)



Basic Information


Item Value
gene id G2113729
gene name LOC106581475
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 19330516 ~ 19330737 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2417144
tccatgtgctcgccagaggtagcctgactgccatcaggtaccgagatgagatcctcagaccccttgtgagaccatatgctggtgcggttggccctgggttcctcctaatgcaagacaatgctagacctcatgtggctggagtgtgtcagcagttcctgcaagaggaaggcattgatgctatggactggcccgcccgttccccagacctgaatccaattgagc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2417144 True 222 lncRNA 0.56 1 19330516 19330737

Neighbor


gene id symbol gene type direction distance location
LOC110508681 LOC106599307 coding upstream 8414 19217481 ~ 19322102 (+)
LOC110508679 LOC106599305 coding upstream 121446 19205372 ~ 19209070 (+)
LOC110508675 LOC106599295 coding upstream 318875 18986697 ~ 19011641 (+)
LOC110508672 NA coding upstream 465102 18849186 ~ 18865414 (+)
LOC110508669 LOC106599285 coding upstream 513930 18726254 ~ 18816586 (+)
LOC110508686 LOC106599593 coding downstream 41272 19372009 ~ 19374568 (+)
LOC110508689 LOC106599321 coding downstream 108888 19439625 ~ 19458620 (+)
LOC118944897 NA coding downstream 120121 19450858 ~ 19450910 (+)
LOC110508179 LOC106599327 coding downstream 200306 19531043 ~ 19542347 (+)
LOC110508279 LOC106599328 coding downstream 255356 19586093 ~ 19589514 (+)
G2113728 NA non-coding upstream 586 19329599 ~ 19329930 (+)
G2113726 NA non-coding upstream 3297 19326970 ~ 19327219 (+)
G2113661 NA non-coding upstream 5809 19313451 ~ 19324707 (+)
G2113705 NA non-coding upstream 46741 19280477 ~ 19283775 (+)
G2113660 NA non-coding upstream 113443 19216873 ~ 19217073 (+)
G2113731 LOC106599592 non-coding downstream 1953 19332690 ~ 19336444 (+)
G2113742 NA non-coding downstream 14922 19345659 ~ 19345913 (+)
G2113745 NA non-coding downstream 16063 19346800 ~ 19347064 (+)
G2113744 NA non-coding downstream 16583 19347320 ~ 19348879 (+)
G2113758 NA non-coding downstream 44694 19375431 ~ 19375636 (+)
G2113578 NA other upstream 254098 19076077 ~ 19076418 (+)
G2113059 NA other upstream 662020 18667115 ~ 18668496 (+)
G2112127 NA other upstream 1426592 17903198 ~ 17903924 (+)
G2111491 NA other upstream 1574935 17754937 ~ 17755581 (+)
G2111457 NA other upstream 1621887 17708256 ~ 17708629 (+)
LOC110508695 LOC106599333 other downstream 292731 19623468 ~ 19636825 (+)
G2115369 NA other downstream 1110996 20441733 ~ 20442169 (+)
LOC110508722 LOC106569260 other downstream 1509833 20840508 ~ 20842019 (+)
G2116347 NA other downstream 2043758 21374495 ~ 21375078 (+)
smg7 smg7 other downstream 3749679 23056778 ~ 23087821 (+)

Expression


G2113729(LOC106581475) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

G2113729(LOC106581475) Expression in each Bioproject

Bar chart with 18 bars.
G2113729(LOC106581475) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network