G2114241 (LOC106599337)



Basic Information


Item Value
gene id G2114241
gene name LOC106599337
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 19805839 ~ 19806179 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2417707
GGTCCAGGGGCTTCCAGTTGTTGGCCCTCAGCTGGTGCAGCTCATCAAACTTCAGGCTGATGTTCTCGATGGACAGCTGGAGCATGTCCCAGAAACCAGCCAGGTCCTGAGAGATGGGCCGCGGGCGGGCGTTGGGGTTCTGATCCCAGACCAGGTTCTCCTCACAAAGTTCCCGGAACTGCTGGAACTTCTGTGACATCAGGAGCTGAGCACTTCCTACGGCAAGCCTCATTTTCCCCAAGA

Function


NR:

description
disks large-associated protein 1-like isoform X4

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2417707 True 243 lncRNA 0.58 2 19805839 19806179
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110508697 LOC106599330 coding upstream 138643 19657025 ~ 19667196 (+)
LOC110508695 LOC106599333 coding upstream 169014 19623468 ~ 19636825 (+)
LOC110508279 LOC106599328 coding upstream 216325 19586093 ~ 19589514 (+)
LOC110508179 LOC106599327 coding upstream 263492 19531043 ~ 19542347 (+)
LOC118944897 NA coding upstream 354929 19450858 ~ 19450910 (+)
LOC110508700 LOC106599341 coding downstream 118702 19924881 ~ 19933094 (+)
LOC110508704 LOC106599349 coding downstream 532044 20338223 ~ 20364502 (+)
LOC110508181 NA coding downstream 594334 20400513 ~ 20413035 (+)
LOC110508707 NA coding downstream 666854 20473033 ~ 20475279 (+)
LOC110508709 LOC106599357 coding downstream 702085 20508264 ~ 20518432 (+)
G2114240 NA non-coding upstream 1862 19802053 ~ 19803977 (+)
G2114206 NA non-coding upstream 45937 19759701 ~ 19759902 (+)
G2114205 NA non-coding upstream 47705 19757839 ~ 19758134 (+)
G2114160 LOC106599334 non-coding upstream 92185 19688017 ~ 19713654 (+)
G2114167 NA non-coding upstream 111525 19693639 ~ 19694314 (+)
G2114401 NA non-coding downstream 222549 20028728 ~ 20028927 (+)
G2114407 NA non-coding downstream 226944 20033123 ~ 20033392 (+)
G2114411 NA non-coding downstream 230835 20037014 ~ 20037302 (+)
G2114415 LOC106599343 non-coding downstream 234839 20041018 ~ 20041544 (+)
G2114426 NA non-coding downstream 246457 20052636 ~ 20139325 (+)
G2113578 NA other upstream 729421 19076077 ~ 19076418 (+)
G2113059 NA other upstream 1137343 18667115 ~ 18668496 (+)
G2112127 NA other upstream 1901915 17903198 ~ 17903924 (+)
G2111491 NA other upstream 2050258 17754937 ~ 17755581 (+)
G2115369 NA other downstream 635554 20441733 ~ 20442169 (+)
LOC110508722 LOC106569260 other downstream 1034391 20840508 ~ 20842019 (+)
G2116347 NA other downstream 1568316 21374495 ~ 21375078 (+)
smg7 smg7 other downstream 3274237 23056778 ~ 23087821 (+)
LOC110508761 LOC106599440 other downstream 3296230 23102409 ~ 23103987 (+)

Expression


G2114241(LOC106599337) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.8.
End of interactive chart.

G2114241(LOC106599337) Expression in each Bioproject

Bar chart with 4 bars.
G2114241(LOC106599337) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network