G2114427



Basic Information


Item Value
gene id G2114427
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 20054350 ~ 20141076 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2417898
ctgtcattgattggcccgtccctaagtcacgcgtcgagctgcagcgctttctcggcttcgcgaacttctatcgtcgtttcatccgtaatttcggtcaggtggcagctcctctcacagcccttacttctgtcaagacgtgctttaagtggtccgtttccgcccagggagcttttgatctcctcaagaatcgttttacatccgcacctatccttgttacacctgacgtcactagacagttcgttgtcgaggttgacgcgtcagaggtgggcgtgggagccattctttctcagcgctccctctctgacgacaaggtccacccttgcgcgtatttttctcatcgcctgtcgccgtcggaacgtaactatgatgtgggaaaccgcgaatggcgacagtggttggagggagcg

Function


NR:

description
PREDICTED: retrotransposon-like protein 1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2417898 True 407 lncRNA 0.55 2 20054350 20141076
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110508700 LOC106599341 coding upstream 121256 19924881 ~ 19933094 (+)
LOC110508697 LOC106599330 coding upstream 387154 19657025 ~ 19667196 (+)
LOC110508695 LOC106599333 coding upstream 417525 19623468 ~ 19636825 (+)
LOC110508279 LOC106599328 coding upstream 464836 19586093 ~ 19589514 (+)
LOC110508179 LOC106599327 coding upstream 512003 19531043 ~ 19542347 (+)
LOC110508704 LOC106599349 coding downstream 197147 20338223 ~ 20364502 (+)
LOC110508181 NA coding downstream 259437 20400513 ~ 20413035 (+)
LOC110508707 NA coding downstream 331957 20473033 ~ 20475279 (+)
LOC110508709 LOC106599357 coding downstream 367188 20508264 ~ 20518432 (+)
LOC110508710 xkr4 coding downstream 392709 20533785 ~ 20621097 (+)
G2114415 LOC106599343 non-coding upstream 12806 20041018 ~ 20041544 (+)
G2114411 NA non-coding upstream 17048 20037014 ~ 20037302 (+)
G2114407 NA non-coding upstream 20958 20033123 ~ 20033392 (+)
G2114401 NA non-coding upstream 25423 20028728 ~ 20028927 (+)
G2114241 LOC106599337 non-coding upstream 248171 19805839 ~ 19806179 (+)
G2114686 NA non-coding downstream 276307 20417383 ~ 20417583 (+)
G2114689 NA non-coding downstream 280316 20421392 ~ 20421640 (+)
G2114690 NA non-coding downstream 280951 20422027 ~ 20422228 (+)
G2114693 NA non-coding downstream 285310 20426386 ~ 20426648 (+)
G2114698 NA non-coding downstream 290272 20431348 ~ 20431581 (+)
G2113578 NA other upstream 977932 19076077 ~ 19076418 (+)
G2113059 NA other upstream 1385854 18667115 ~ 18668496 (+)
G2112127 NA other upstream 2150426 17903198 ~ 17903924 (+)
G2111491 NA other upstream 2298769 17754937 ~ 17755581 (+)
G2115369 NA other downstream 300657 20441733 ~ 20442169 (+)
LOC110508722 LOC106569260 other downstream 699494 20840508 ~ 20842019 (+)
G2116347 NA other downstream 1233419 21374495 ~ 21375078 (+)
smg7 smg7 other downstream 2939340 23056778 ~ 23087821 (+)
LOC110508761 LOC106599440 other downstream 2961333 23102409 ~ 23103987 (+)

Expression


G2114427 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G2114427 Expression in each Bioproject

Bar chart with 20 bars.
G2114427 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network