G2117798 (pappa2)



Basic Information


Item Value
gene id G2117798
gene name pappa2
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 22228142 ~ 22228388 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2421607
CCACCATCATGGCCCGTCAGTGGGTGGTCACACTCCGCATCACAGTGCCTGTTACCAATCTTACTGATCTGGCAGTTGCTTAGGATGAAGCGCTGGCGTAGAGATGTGTTCTGGATGGTATGCGTGCTCAGCTCCAAGCTGATGTTGTGGGACCGGAAGGCTTCGACAAGTGCCTGGTGCTGCTGCTGGATCTGGGCATGGGAGACGGTGGGACGACTTCCGTCGTCGTTACAGATGTTGACAATGC

Function


symbol description
pappa2 Enables peptidase activity. Acts upstream of or within several processes, including angiogenesis; notochord development; and regulation of Notch signaling pathway. Is expressed in several structures, including axial mesoderm; bone tissue; nervous system; pleuroperitoneal region; and ventral mandibular arch. Orthologous to human PAPPA2 (pappalysin 2).

NR:

description
pappalysin-2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2421607 True 247 lncRNA 0.56 1 22228142 22228388

Neighbor


gene id symbol gene type direction distance location
cop1 rfwd2 coding downstream 15716 22202448 ~ 22212426 (-)
tnr tnr coding downstream 102841 21966295 ~ 22125301 (-)
LOC110508740 kiaa0040 coding downstream 279585 21942981 ~ 21948557 (-)
mrps14 mrps14 coding downstream 351433 21873216 ~ 21876709 (-)
LOC110508737 cacybp coding downstream 361107 21864614 ~ 21867035 (-)
astn1 astn1 coding upstream 58278 22286666 ~ 22527081 (-)
dars2 dars2 coding upstream 567251 22795639 ~ 22816743 (-)
LOC110508750 LOC106569069 coding upstream 593684 22822072 ~ 22828641 (-)
LOC110508754 shcbp1l coding upstream 705872 22934260 ~ 22939565 (-)
nmnat2 nmnat2 coding upstream 814150 23042538 ~ 23055346 (-)
G2117797 pappa2 non-coding downstream 124 22227659 ~ 22228018 (-)
G2117793 pappa2 non-coding downstream 4289 22223560 ~ 22223853 (-)
G2117792 NA non-coding downstream 5107 22222835 ~ 22223035 (-)
G2117790 NA non-coding downstream 6288 22221630 ~ 22221854 (-)
G2117567 NA non-coding downstream 13488 22214259 ~ 22214654 (-)
G2117807 NA non-coding upstream 11144 22239532 ~ 22239749 (-)
G2117821 pappa2 non-coding upstream 19960 22248348 ~ 22248618 (-)
G2117823 NA non-coding upstream 21804 22250192 ~ 22250405 (-)
G2117830 NA non-coding upstream 32914 22261302 ~ 22261524 (-)
G2117840 NA non-coding upstream 50009 22278397 ~ 22280880 (-)
G2117313 NA other downstream 357089 21870685 ~ 21871053 (-)
G2115838 NA other downstream 1368612 20859140 ~ 20859530 (-)
LOC110508678 LOC105024244 other downstream 3106086 19116082 ~ 19185326 (-)
G2118200 brinp2 other upstream 366145 22594533 ~ 22607806 (-)
LOC110508185 LOC106569033 other upstream 1096613 23317575 ~ 23353162 (-)
LOC110508783 LOC106599501 other upstream 2436486 24664869 ~ 24677152 (-)
G2120836 NA other upstream 2502286 24730674 ~ 24734987 (-)
G2121444 LOC106599515 other upstream 2915674 25144062 ~ 25148520 (-)

Expression



Co-expression Network