G2117821 (pappa2)



Basic Information


Item Value
gene id G2117821
gene name pappa2
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 22248348 ~ 22248618 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2421651
GTAAGCAGAGTTTGCTGGACCAGATCGCCTGAAAATGGCGGTTGCCGGACAACTCGGTAGATCAGAGGCTGGCAACTGGAGCAGAGAGGATTATGGGGGCCAGAAGTAAGCAGAACAGCGTCAATCTCCATCTTCTCATCAAAGGTGCTCAGTTTGACAGCTGCCACCCTTTTTTCGGTGTGCACATGTAGGGTGAGGGGCACATCACAGAAGACGTGCTGTGGACCCATGTCTAGAGACTCGTCTGTGTCTGTTATTAGCTCGATGTTGG

Function


symbol description
pappa2 Enables peptidase activity. Acts upstream of or within several processes, including angiogenesis; notochord development; and regulation of Notch signaling pathway. Is expressed in several structures, including axial mesoderm; bone tissue; nervous system; pleuroperitoneal region; and ventral mandibular arch. Orthologous to human PAPPA2 (pappalysin 2).

NR:

description
PREDICTED: pappalysin-2 isoform X2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2421651 True 271 lncRNA 0.52 1 22248348 22248618

Neighbor


gene id symbol gene type direction distance location
cop1 rfwd2 coding downstream 35922 22202448 ~ 22212426 (-)
tnr tnr coding downstream 123047 21966295 ~ 22125301 (-)
LOC110508740 kiaa0040 coding downstream 299791 21942981 ~ 21948557 (-)
mrps14 mrps14 coding downstream 371639 21873216 ~ 21876709 (-)
LOC110508737 cacybp coding downstream 381313 21864614 ~ 21867035 (-)
astn1 astn1 coding upstream 38048 22286666 ~ 22527081 (-)
dars2 dars2 coding upstream 547021 22795639 ~ 22816743 (-)
LOC110508750 LOC106569069 coding upstream 573454 22822072 ~ 22828641 (-)
LOC110508754 shcbp1l coding upstream 685642 22934260 ~ 22939565 (-)
nmnat2 nmnat2 coding upstream 793920 23042538 ~ 23055346 (-)
G2117807 NA non-coding downstream 8599 22239532 ~ 22239749 (-)
G2117798 pappa2 non-coding downstream 19960 22228142 ~ 22228388 (-)
G2117797 pappa2 non-coding downstream 20330 22227659 ~ 22228018 (-)
G2117793 pappa2 non-coding downstream 24495 22223560 ~ 22223853 (-)
G2117792 NA non-coding downstream 25313 22222835 ~ 22223035 (-)
G2117823 NA non-coding upstream 1574 22250192 ~ 22250405 (-)
G2117830 NA non-coding upstream 12684 22261302 ~ 22261524 (-)
G2117840 NA non-coding upstream 29779 22278397 ~ 22280880 (-)
G2118030 NA non-coding upstream 296043 22544661 ~ 22544893 (-)
G2118194 NA non-coding upstream 337130 22585748 ~ 22601652 (-)
G2117313 NA other downstream 377295 21870685 ~ 21871053 (-)
G2115838 NA other downstream 1388818 20859140 ~ 20859530 (-)
LOC110508678 LOC105024244 other downstream 3126292 19116082 ~ 19185326 (-)
G2118200 brinp2 other upstream 345915 22594533 ~ 22607806 (-)
LOC110508185 LOC106569033 other upstream 1076383 23317575 ~ 23353162 (-)
LOC110508783 LOC106599501 other upstream 2416256 24664869 ~ 24677152 (-)
G2120836 NA other upstream 2482056 24730674 ~ 24734987 (-)
G2121444 LOC106599515 other upstream 2895444 25144062 ~ 25148520 (-)

Expression



Co-expression Network