G2118200 (brinp2)


Basic Information

Item Value
gene id G2118200
gene name brinp2
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 22594533 ~ 22607806 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2422040
GAAGCTATTTTGAGAACAAACTGCGATGCGCAACAACATCCCTTAGCCACATAGCCTAGAGCAAAGTGCCACTGAGTCGGTGTATGTGAAGCTGCTTACCTCCTAGCGTAGCAGACACCAGAAAGTGTGTCCCATATTTCTTGATCAAGTTCTCGTGGATCTGCTGCAGACTTGGCCTTCGACCGAGCAGCCTCAGGTTGCGTAGAAACTCCGGCGCCAGTGGCAAGGGGGCCTTAAAAACGTCCCTCTTCTCTGTAGCCAAGCTGTTTACTTTCCAATGGCTGAATTCCCTGCAAGTGAACCTGTAGATCTTATAGCGTGTGGAGAAGCCTTGCTGGAAGCGTTCTTTGAACTCTGTGTATTCCGGACAACGGTGGAAAGGTCCCTTCTCAGACAGCAGCCAATCCAATTGGTCGCCACTCTGGTGTCCGGTGCTGGCAGCTGTAAGCGAGGGGTTGTTACTCTGCTGCCCCTCAGCCAGGGCCAGAACCCAGCCGAGGTGGCCCAGCACTGTCCACTGCCATACGAGCATCAACAGCAACCATCTAACAGCTGTGGCTCTTGGCCAACGCATCACCATCTTCCTGTTGGGCACCTGGGACCAGCATTCTTCAA

Function

symbol description
brinp2 Predicted to be involved in cellular response to retinoic acid; negative regulation of mitotic cell cycle; and positive regulation of neuron differentiation. Predicted to act upstream of or within regulation of cell cycle. Predicted to be active in dendrite; endoplasmic reticulum; and neuronal cell body. Is expressed in several structures, including fin bud; gill; head; heart; and muscle. Human ortholog(s) of this gene implicated in oral squamous cell carcinoma. Orthologous to human BRINP2 (BMP/retinoic acid inducible neural specific 2).

NR:

description
BMP/retinoic acid-inducible neural-specific protein 2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2422040 True 615 TUCP 0.53 2 22594533 22607806

Neighbor

gene id symbol gene type direction distance location
astn1 astn1 coding downstream 67452 22286666 ~ 22527081 (-)
cop1 rfwd2 coding downstream 382107 22202448 ~ 22212426 (-)
tnr tnr coding downstream 469232 21966295 ~ 22125301 (-)
LOC110508740 kiaa0040 coding downstream 645976 21942981 ~ 21948557 (-)
mrps14 mrps14 coding downstream 717824 21873216 ~ 21876709 (-)
dars2 dars2 coding upstream 187833 22795639 ~ 22816743 (-)
LOC110508750 LOC106569069 coding upstream 214266 22822072 ~ 22828641 (-)
LOC110508754 shcbp1l coding upstream 326454 22934260 ~ 22939565 (-)
nmnat2 nmnat2 coding upstream 434732 23042538 ~ 23055346 (-)
LOC110508760 LOC106599438 coding upstream 496265 23104071 ~ 23118323 (-)
G2118030 NA non-coding downstream 49640 22544661 ~ 22544893 (-)
G2117840 NA non-coding downstream 313653 22278397 ~ 22280880 (-)
G2117830 NA non-coding downstream 333009 22261302 ~ 22261524 (-)
G2117823 NA non-coding downstream 344128 22250192 ~ 22250405 (-)
G2117821 pappa2 non-coding downstream 345915 22248348 ~ 22248618 (-)
G2118250 NA non-coding upstream 66858 22674664 ~ 22674929 (-)
G2118251 NA non-coding upstream 69391 22677197 ~ 22677415 (-)
G2118359 NA non-coding upstream 184613 22792419 ~ 22792756 (-)
G2118394 NA non-coding upstream 186285 22794091 ~ 22794319 (-)
G2119243 NA non-coding upstream 194030 22801836 ~ 22803785 (-)
G2117313 NA other downstream 723480 21870685 ~ 21871053 (-)
G2115838 NA other downstream 1735003 20859140 ~ 20859530 (-)
LOC110508678 LOC105024244 other downstream 3472477 19116082 ~ 19185326 (-)
LOC110508185 LOC106569033 other upstream 717195 23317575 ~ 23353162 (-)
LOC110508783 LOC106599501 other upstream 2057068 24664869 ~ 24677152 (-)
G2120836 NA other upstream 2122868 24730674 ~ 24734987 (-)
G2121444 LOC106599515 other upstream 2536256 25144062 ~ 25148520 (-)
G2121457 NA other upstream 2590442 25198248 ~ 25274626 (-)

Expression


Co-expression Network