G2124012



Basic Information


Item Value
gene id G2124012
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 28114374 ~ 28114741 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2428516
TGTAACATGTCCCATAACCCTGTTCATGTCTATGTAACATGTCCCATAACCCTGTTCATGTCTATGTAACATGTCCCATAACCCTGTTCATGTCTATGTAACATGTCCCATAACCCTGTTCATGTCTATGTAACATGTCTCATAACCCTGTTCATGTCTATGTAACATGTCCCATAACCCTGTTCATGTCTATGTAACATGTCCCATAACCCTGTTCATGTCTATGTAACTGCCATTTAAATACATGGGTTTTATTTAGCGCCACTAAAAAATACTGAACTGAAAAGTTGTTGCAAAGTTTATC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2428516 True 304 lncRNA 0.38 2 28114374 28114741
Loading

Neighbor


gene id symbol gene type direction distance location
rwdd3 rwdd3 coding upstream 1797 28105364 ~ 28113908 (+)
LOC110508846 LOC106599140 coding upstream 10464 28090839 ~ 28103910 (+)
LOC110508844 tm56b coding upstream 27179 28079201 ~ 28087195 (+)
LOC110508842 LOC106599146 coding upstream 115963 27984309 ~ 27998411 (+)
LOC110508840 LOC106599145 coding upstream 152455 27945086 ~ 27961919 (+)
LOC110508848 LOC106599136 coding downstream 45742 28160483 ~ 28170310 (+)
LOC110508851 LOC106599130 coding downstream 407476 28522217 ~ 28551515 (+)
palmda LOC106599129 coding downstream 478243 28592984 ~ 28609915 (+)
LOC110508852 LOC106599122 coding downstream 496748 28611489 ~ 28622256 (+)
LOC110508853 LOC106599119 coding downstream 525397 28640138 ~ 28649444 (+)
G2123983 NA non-coding upstream 68617 28041405 ~ 28045757 (+)
G2123973 NA non-coding upstream 86758 28026738 ~ 28027616 (+)
G2123950 LOC106599142 non-coding upstream 133365 27979697 ~ 27981009 (+)
LOC110508839 LOC106599148 non-coding upstream 174124 27937837 ~ 27944746 (+)
G2124038 NA non-coding downstream 32414 28147155 ~ 28147456 (+)
G2124039 NA non-coding downstream 34258 28148999 ~ 28149201 (+)
G2124851 NA non-coding downstream 267999 28382740 ~ 28383007 (+)
G2124862 NA non-coding downstream 274281 28389022 ~ 28389233 (+)
G2124885 NA non-coding downstream 293601 28408342 ~ 28408842 (+)
LOC110508827 LOC106599210 other upstream 390386 27720549 ~ 27725061 (+)
G2123170 NA other upstream 1005092 27106034 ~ 27109282 (+)
G2123174 NA other upstream 1010104 27101312 ~ 27104270 (+)
G2123101 NA other upstream 1169187 26942200 ~ 26945187 (+)
LOC110508797 LOC106599544 other upstream 1425868 26679791 ~ 26688506 (+)
LOC110508880 NA other downstream 1156044 29270737 ~ 29274454 (+)
G2125614 LOC106599059 other downstream 1206002 29320743 ~ 29323384 (+)
G2126497 NA other downstream 2095506 30210247 ~ 30211633 (+)
kcnn1a LOC106598974 other downstream 2420110 30534338 ~ 30592397 (+)

Expression


G2124012 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G2124012 Expression in each Bioproject

Bar chart with 17 bars.
G2124012 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network