G2128516



Basic Information


Item Value
gene id G2128516
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 31882752 ~ 31883097 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2433650
aattattcagcccccttaagttaatactttgtagcgccaccttttgctgcgattacagctgtaagtcgcttggggtatgtctcttatcagttttgcacatcgagagactgaaattttttcccattcctccttgcaaaacagctcgagctcagtgaggttggatggagagcatttgtgaacagcagttttcagttctttccacagattctcgattggattcaggtctggactttgacttggccattctaacacctggatatgtttatttttgaaccattccattgtagattttgcgttatgttttggatcattgtcttgttggaagacaaatctccgtcccagtctc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2433650 True 346 lncRNA 0.42 1 31882752 31883097
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110508971 LOC100195537 coding upstream 8023 31870378 ~ 31874729 (+)
LOC110508969 LOC106598864 coding upstream 78699 31794423 ~ 31804053 (+)
LOC118944877 NA coding upstream 106712 31771805 ~ 31776040 (+)
LOC110508967 LOC106598876 coding upstream 204191 31664814 ~ 31678561 (+)
LOC110508221 LOC106598877 coding upstream 239290 31594783 ~ 31643462 (+)
LOC110508974 LOC106599183 coding downstream 50665 31933762 ~ 31935806 (+)
cldn1 LOC106598850 coding downstream 74538 31957635 ~ 31961212 (+)
LOC110508980 bcl6 coding downstream 132049 32015146 ~ 32020881 (+)
LOC110508981 LOC106598847 coding downstream 146492 32029589 ~ 32032860 (+)
LOC110508984 NA coding downstream 170134 32053231 ~ 32055655 (+)
G2128482 LOC106598862 non-coding upstream 54909 31826074 ~ 31827843 (+)
G2128458 NA non-coding upstream 111467 31770896 ~ 31771285 (+)
G2128452 NA non-coding upstream 112741 31769706 ~ 31770011 (+)
G2128183 NA non-coding upstream 143701 31715995 ~ 31739051 (+)
G2128179 NA non-coding upstream 171398 31710816 ~ 31711354 (+)
LOC110508972 LOC106598853 non-coding downstream 35150 31880157 ~ 31921755 (+)
G2128456 NA non-coding downstream 39000 31922097 ~ 31922749 (+)
G2128614 NA non-coding downstream 62067 31945164 ~ 31948898 (+)
G2128653 NA non-coding downstream 151724 32034821 ~ 32037428 (+)
G2128189 NA other upstream 142682 31739312 ~ 31740070 (+)
G2127299 LOC106598972 other upstream 1241509 30640687 ~ 30641243 (+)
kcnn1a LOC106598974 other upstream 1314174 30534338 ~ 30592397 (+)
G2126497 NA other upstream 1671119 30210247 ~ 30211633 (+)
G2128753 NA other downstream 386221 32269318 ~ 32274380 (+)
pfn2l LOC106598797 other downstream 748192 32631289 ~ 32700844 (+)
G2129371 crb1 other downstream 865831 32748928 ~ 32749568 (+)

Expression


G2128516 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G2128516 Expression in each Bioproject

Bar chart with 17 bars.
G2128516 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network