G2129406



Basic Information


Item Value
gene id G2129406
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 32923200 ~ 32923666 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2434739
acatgtctataagccgcaggtgcctaccggtacattgaaacaaatgaactttacacagcctttaaacaaaacacggcttgtaacaaaaataaaacagtagcctaccaagaaagtcattggtcactatcttcctcctcctgtgcactgaaaccactgaagtcatctccttcggtgtcggagttgaatagcctcagaattgcttcatccgatgttggatcgctgccctcttcaacacgcagcagtccagcctttcgaaacccgttgatgatagtggattttttgacaatgctccacgctgtcagcagctctatttccttttccaacagccagatcgatcgccttcaacttgaaagctgcatcatatgcatttctccgtgtctttgccatgatgagggtgacaaaatgactaccgtaatcagaatgatggga

Function


NR:

description
PREDICTED: pogo transposable element with KRAB domain

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2434739 True 429 lncRNA 0.45 2 32923200 32923666

Neighbor


gene id symbol gene type direction distance location
LOC110509022 b3galt2 coding upstream 11268 32872931 ~ 32911932 (+)
LOC110508224 kcnt2 coding upstream 86762 32814704 ~ 32836798 (+)
zbtb41 zbtb41 coding upstream 138911 32759166 ~ 32803922 (+)
LOC110509011 LOC106598790 coding upstream 204353 32710595 ~ 32718847 (+)
LOC110509009 LOC106598794 coding upstream 232701 32685536 ~ 32690499 (+)
LOC110509024 LOC106598521 coding downstream 126946 33050612 ~ 33070407 (+)
LOC110509025 LOC106598617 coding downstream 200806 33124472 ~ 33126977 (+)
LOC110509026 LOC106598516 coding downstream 232975 33156641 ~ 33165714 (+)
LOC110508226 LOC106598614 coding downstream 253086 33176752 ~ 33212483 (+)
LOC118944857 LOC106568727 coding downstream 307856 33231522 ~ 33247262 (+)
G2129307 NA non-coding upstream 68833 32854020 ~ 32854367 (+)
G2129389 NA non-coding upstream 79907 32843083 ~ 32843293 (+)
G2129300 NA non-coding upstream 82364 32838135 ~ 32840836 (+)
G2129385 NA non-coding upstream 104392 32818520 ~ 32818808 (+)
G2129411 trove2 non-coding downstream 6406 32930072 ~ 32930623 (+)
G2129429 rgs1 non-coding downstream 31286 32954952 ~ 32957377 (+)
G2129522 NA non-coding downstream 167485 33091151 ~ 33092647 (+)
G2129530 NA non-coding downstream 182310 33105976 ~ 33106435 (+)
G2129552 NA non-coding downstream 230892 33154558 ~ 33154799 (+)
G2129371 crb1 other upstream 173632 32748928 ~ 32749568 (+)
pfn2l LOC106598797 other upstream 222356 32631289 ~ 32700844 (+)
G2128753 NA other upstream 648820 32269318 ~ 32274380 (+)
LOC110508984 NA other upstream 867545 32053231 ~ 32055655 (+)
G2129639 LOC106598496 other downstream 384432 33308098 ~ 33308991 (+)
G2129708 NA other downstream 508085 33431751 ~ 33432107 (+)
G2129724 LOC106598452 other downstream 528546 33452212 ~ 33452873 (+)
G2129765 LOC106598425 other downstream 648442 33572108 ~ 33575970 (+)

Expression



Co-expression Network