G2129859



Basic Information


Item Value
gene id G2129859
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 33729148 ~ 33729528 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2435288
ggttacagagagctggtagtcccatccaccaaactaccaggtgtgaaacagggaagggactcagggggtatgctaatttggtatagcgcagacctaactcactccgttaaattaatcaaaacaggaacattttacatttggctagaaattcaaaaggaaattatcttaacagagaaaaatgtcctcctgtgtgctacctatatccctccactagaatccccatactttaatgaagacagcttctccatcctggagggggaaatcaatcatttccaggcccagggacatgtactagtctgtggtgacctaaatgccagaaccggacaagaacctgataccctcagcacacagggggacaaacacctgcctgcaggtgacagc

Function


NR:

description
PREDICTED: RNA-directed DNA polymerase from mobile element jockey-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2435288 True 381 TUCP 0.46 1 33729148 33729528

Neighbor


gene id symbol gene type direction distance location
LOC110509039 LOC106598420 coding upstream 113109 33583098 ~ 33616039 (+)
LOC118944849 NA coding upstream 169596 33558282 ~ 33559552 (+)
LOC110509035 LOC106598436 coding upstream 176706 33526684 ~ 33552442 (+)
LOC118944861 NA coding upstream 210644 33513572 ~ 33520317 (+)
LOC110509029 LOC106598504 coding upstream 454384 33248650 ~ 33274764 (+)
LOC110508288 LOC106598607 coding downstream 78492 33808020 ~ 33810797 (+)
cfap57 LOC106598390 coding downstream 82085 33811613 ~ 33850430 (+)
LOC110509044 LOC106598377 coding downstream 198691 33928219 ~ 33938027 (+)
LOC110509047 LOC106598344 coding downstream 284367 34013895 ~ 34018374 (+)
LOC110509049 LOC106598340 coding downstream 300314 34029842 ~ 34035930 (+)
G2129853 NA non-coding upstream 9376 33719463 ~ 33719772 (+)
G2129848 LOC106598404 non-coding upstream 30606 33698050 ~ 33698542 (+)
G2129847 NA non-coding upstream 31816 33697093 ~ 33697332 (+)
G2129841 NA non-coding upstream 38634 33690163 ~ 33690514 (+)
G2129838 NA non-coding upstream 45336 33683438 ~ 33683812 (+)
G2129860 NA non-coding downstream 165 33729693 ~ 33730731 (+)
G2129862 NA non-coding downstream 3776 33733304 ~ 33733514 (+)
G2129868 NA non-coding downstream 15954 33745482 ~ 33745693 (+)
G2129872 NA non-coding downstream 20467 33749995 ~ 33750401 (+)
G2129765 LOC106598425 other upstream 153178 33572108 ~ 33575970 (+)
G2129724 LOC106598452 other upstream 276275 33452212 ~ 33452873 (+)
G2129708 NA other upstream 297041 33431751 ~ 33432107 (+)
G2129639 LOC106598496 other upstream 420157 33308098 ~ 33308991 (+)
LOC110509024 LOC106598521 other upstream 659978 33050612 ~ 33070407 (+)
G2130731 NA other downstream 278103 34007631 ~ 34008262 (+)
G2130749 LOC106598333 other downstream 309264 34038792 ~ 34069094 (+)
LOC110508236 LOC106598267 other downstream 641333 34352592 ~ 34409491 (+)
G2131383 NA other downstream 873957 34603485 ~ 34604953 (+)
G2131416 NA other downstream 957743 34687271 ~ 34687640 (+)

Expression


G2129859 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G2129859 Expression in each Bioproject

Bar chart with 20 bars.
G2129859 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network