G2132017



Basic Information


Item Value
gene id G2132017
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 35356424 ~ 35356694 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2437805
tatcccaaaaactctgttttgttggcgcattgtgttcagtaatacaatggctcaaaggaggtcaaaacatgcagacgaatacatcctaatagtaccggcaaagtttgttgaaacatgtcaaacgatgttcataattaatcctcacgttcgttgtcaattgtctaaataatacattttcaaccggacaattgcgtattcaatagaaatgaaaaacaacgaagggcgcgcactctgtcacgcgcgcaaaccagtactgcatgcttcctcagtc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2437805 True 271 lncRNA 0.41 1 35356424 35356694
Loading

Neighbor


gene id symbol gene type direction distance location
trnak-uuu-278 NA coding upstream 400 35355952 ~ 35356024 (+)
trnak-uuu-277 NA coding upstream 1959 35354393 ~ 35354465 (+)
trnak-uuu-276 NA coding upstream 3518 35352834 ~ 35352906 (+)
trnak-uuu-275 NA coding upstream 5072 35351280 ~ 35351352 (+)
trnak-uuu-274 NA coding upstream 6631 35349721 ~ 35349793 (+)
trnak-uuu-279 NA coding downstream 821 35357515 ~ 35357587 (+)
trnak-uuu-280 NA coding downstream 2380 35359074 ~ 35359146 (+)
trnak-uuu-281 NA coding downstream 3939 35360633 ~ 35360705 (+)
trnak-uuu-282 NA coding downstream 5498 35362192 ~ 35362264 (+)
trnak-uuu-283 NA coding downstream 7057 35363751 ~ 35363823 (+)
G2132015 NA non-coding upstream 21260 35334906 ~ 35335164 (+)
G2132005 NA non-coding upstream 62668 35245289 ~ 35293756 (+)
G2132004 NA non-coding upstream 114729 35189856 ~ 35241695 (+)
G2132000 NA non-coding upstream 186773 35132427 ~ 35169651 (+)
G2131978 NA non-coding upstream 241260 35114958 ~ 35115164 (+)
G2132031 NA non-coding downstream 38834 35395528 ~ 35395734 (+)
G2132033 NA non-coding downstream 41533 35398227 ~ 35398458 (+)
G2132039 NA non-coding downstream 53975 35410669 ~ 35410875 (+)
G2132043 NA non-coding downstream 68517 35425211 ~ 35425422 (+)
G2132049 NA non-coding downstream 75815 35432509 ~ 35432826 (+)
G2131933 NA other upstream 263390 35091699 ~ 35093034 (+)
G2131426 NA other upstream 573006 34702206 ~ 34783418 (+)
G2131416 NA other upstream 668784 34687271 ~ 34687640 (+)
G2131383 NA other upstream 751471 34603485 ~ 34604953 (+)
LOC110508236 LOC106598267 other upstream 982414 34352592 ~ 34409491 (+)
G2132291 NA other downstream 343152 35699846 ~ 35700235 (+)
LOC110508289 LOC106597230 other downstream 616745 35973386 ~ 35975132 (+)
G2132519 LOC100380659 other downstream 982400 36339094 ~ 36364994 (+)
G2132611 LOC100380659 other downstream 1008862 36365556 ~ 36369967 (+)
LOC110509112 LOC106597339 other downstream 1166060 36522754 ~ 36528580 (+)

Expression


G2132017 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 80.
End of interactive chart.

G2132017 Expression in each Bioproject

Bar chart with 5 bars.
G2132017 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.

Co-expression Network