G2132039



Basic Information


Item Value
gene id G2132039
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 35410669 ~ 35410875 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2437827
aaaagaaaaccagccccgtcacggaccaggatgtcttgctcccaggcagactaaatcacttttttgcccgctttgaggacaatacagtgccactgacacggcccgcaactaaaacatgcggactctccttcactgcagccgacgtgaggaaaacatttaaacgtgtcaaccctcgcaaggctgcaagcccagacggcatccccaacc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2437827 True 207 lncRNA 0.54 1 35410669 35410875
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110509087 LOC106588083 coding upstream 25744 35372225 ~ 35384925 (+)
trnak-uuu-285 NA coding upstream 43733 35366864 ~ 35366936 (+)
trnak-uuu-284 NA coding upstream 45287 35365310 ~ 35365382 (+)
trnak-uuu-283 NA coding upstream 46846 35363751 ~ 35363823 (+)
trnak-uuu-282 NA coding upstream 48405 35362192 ~ 35362264 (+)
LOC110509092 LOC106597187 coding downstream 441675 35852550 ~ 35864073 (+)
LOC110508289 LOC106597230 coding downstream 562511 35973386 ~ 35975132 (+)
LOC110509094 LOC106597143 coding downstream 574640 35985515 ~ 35998946 (+)
riok1 riok1 coding downstream 617672 36028547 ~ 36039262 (+)
LOC110509101 LOC106597086 coding downstream 697751 36108626 ~ 36178080 (+)
G2132033 NA non-coding upstream 12211 35398227 ~ 35398458 (+)
G2132031 NA non-coding upstream 14935 35395528 ~ 35395734 (+)
G2132017 NA non-coding upstream 53975 35356424 ~ 35356694 (+)
G2132015 NA non-coding upstream 75505 35334906 ~ 35335164 (+)
G2132005 NA non-coding upstream 116913 35245289 ~ 35293756 (+)
G2132043 NA non-coding downstream 14336 35425211 ~ 35425422 (+)
G2132049 NA non-coding downstream 21634 35432509 ~ 35432826 (+)
G2132050 NA non-coding downstream 22268 35433143 ~ 35433362 (+)
G2132058 NA non-coding downstream 50534 35461409 ~ 35461618 (+)
G2132063 LOC106584099 non-coding downstream 66094 35476969 ~ 35477208 (+)
G2131933 NA other upstream 317635 35091699 ~ 35093034 (+)
G2131426 NA other upstream 627251 34702206 ~ 34783418 (+)
G2131416 NA other upstream 723029 34687271 ~ 34687640 (+)
G2131383 NA other upstream 805716 34603485 ~ 34604953 (+)
LOC110508236 LOC106598267 other upstream 1036659 34352592 ~ 34409491 (+)
G2132291 NA other downstream 288971 35699846 ~ 35700235 (+)
G2132519 LOC100380659 other downstream 928219 36339094 ~ 36364994 (+)
G2132611 LOC100380659 other downstream 954681 36365556 ~ 36369967 (+)
LOC110509112 LOC106597339 other downstream 1111879 36522754 ~ 36528580 (+)

Expression


G2132039 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G2132039 Expression in each Bioproject

Bar chart with 16 bars.
G2132039 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network