G2133040



Basic Information


Item Value
gene id G2133040
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 36438508 ~ 36438901 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2439022
actgggacggagatttgtcttccaacaagacaatgatccaaaacataaagcaaaatctacaatggaatggttcaaaaataaacatatccaggtgttagaatggccaagtcaaagtccagacctgaatccaatcgagaatctgtggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgagctcgagctgttttgcaaggaggagtgggaaaaaaattcagtctctcgatgtgcaaaactgatagagacataccccaagcgacttacagctgtaatcgcagcaaaaggtggcgctacaaagtattaacttaagggggctgaatgattttgcacgcccaatttttcagtttttgatttgttaaaaaagtttgaaatatcc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2439022 True 394 lncRNA 0.40 1 36438508 36438901
Loading

Neighbor


gene id symbol gene type direction distance location
abcf2a abcf2 coding downstream 1491 36424954 ~ 36437017 (-)
faim2a LOC106597016 coding downstream 18492 36400409 ~ 36420016 (-)
LOC118944889 LOC100380659 coding downstream 39749 36391274 ~ 36398759 (-)
LOC110508243 LOC100380659 coding downstream 47485 36339085 ~ 36391023 (-)
LOC110509104 NA coding downstream 192527 36243661 ~ 36245981 (-)
LOC110508244 LOC106597000 coding upstream 4322 36443223 ~ 36454287 (-)
LOC110509111 LOC106597319 coding upstream 87893 36526794 ~ 36557532 (-)
LOC110509116 LOC106597376 coding upstream 359544 36798445 ~ 36958711 (-)
LOC118944834 NA coding upstream 561622 37000523 ~ 37001147 (-)
impa1 impa1 coding upstream 875710 37314611 ~ 37333488 (-)
G2133058 NA non-coding downstream 697 36437593 ~ 36437811 (-)
G2133057 NA non-coding downstream 1064 36437245 ~ 36437444 (-)
G2133052 NA non-coding downstream 67355 36370544 ~ 36371153 (-)
G2133115 NA non-coding upstream 136477 36575378 ~ 36578143 (-)
G2133134 NA non-coding upstream 170231 36609132 ~ 36609348 (-)
G2133135 NA non-coding upstream 172675 36611576 ~ 36611832 (-)
G2133144 NA non-coding upstream 184283 36623184 ~ 36623559 (-)
G2133150 NA non-coding upstream 190676 36629577 ~ 36629803 (-)
G2133007 NA other downstream 175178 36263002 ~ 36263330 (-)
G2132966 NA other downstream 188733 36235515 ~ 36249775 (-)
G2132971 NA other downstream 213129 36224213 ~ 36225379 (-)
LOC118944844 riok1 other downstream 413307 36023714 ~ 36025735 (-)
lyrm4 lyrm4 other downstream 420676 36005489 ~ 36017873 (-)
LOC110509127 LOC106596915 other upstream 1327817 37766370 ~ 37996222 (-)
G2134625 NA other upstream 1689228 38128129 ~ 38130407 (-)
G2135034 LOC106596897 other upstream 2080670 38519571 ~ 38526920 (-)
G2135837 NA other upstream 2566560 39005461 ~ 39006050 (-)

Expression


G2133040 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G2133040 Expression in each Bioproject

Bar chart with 20 bars.
G2133040 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.

Co-expression Network