G2133229


Basic Information

Item Value
gene id G2133229
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 36722316 ~ 36722590 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2439221
gactgggggtcagcctgatgaaccaaactactcagtaatctcctccatgtagactgggggtcagcctgatgaaccaaactactcagtaatctcctccatggagactgggggtcagcctgatgaaccaaactactcagtaatctcctccatgtagactgggggtcagcctgatgaaccaaactactcagtaatctcctccatgtagactgggggtcagcctgatgaaccaaactactcagtaatctcctccatgaagactgggggtcagcctgatg

Function

NR:

description
NACHT, LRR and PYD domains-containing protein 3-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2439221 True 275 lncRNA 0.51 1 36722316 36722590

Neighbor

gene id symbol gene type direction distance location
trnas-cga-50 NA coding upstream 34496 36687739 ~ 36687820 (+)
trnas-uga-130 NA coding upstream 34655 36687580 ~ 36687661 (+)
trnas-cga-49 NA coding upstream 35673 36686562 ~ 36686643 (+)
trnas-cga-48 NA coding upstream 37267 36684968 ~ 36685049 (+)
trnas-cga-47 NA coding upstream 38855 36683380 ~ 36683461 (+)
LOC118944833 NA coding downstream 254584 36977174 ~ 36982260 (+)
c28h7orf25 cssa03h7orf25 coding downstream 715442 37438032 ~ 37442898 (+)
LOC110509119 rala coding downstream 725149 37447739 ~ 37470801 (+)
LOC110509126 LOC106596905 coding downstream 902908 37625498 ~ 37650985 (+)
LOC110509125 LOC106596905 coding downstream 952228 37674818 ~ 37694631 (+)
G2133199 NA non-coding upstream 27312 36694317 ~ 36695004 (+)
G2133191 NA non-coding upstream 34788 36686955 ~ 36687528 (+)
G2133149 NA non-coding upstream 92447 36629580 ~ 36629869 (+)
G2133132 NA non-coding upstream 115137 36606925 ~ 36607179 (+)
G2132700 NA non-coding upstream 153956 36567326 ~ 36568360 (+)
G2133231 NA non-coding downstream 4527 36727117 ~ 36727418 (+)
G2133247 NA non-coding downstream 37269 36759859 ~ 36760060 (+)
G2133251 NA non-coding downstream 47824 36770414 ~ 36770618 (+)
G2133253 NA non-coding downstream 53639 36776229 ~ 36776437 (+)
G2133258 NA non-coding downstream 58917 36781507 ~ 36781706 (+)
LOC110509112 LOC106597339 other upstream 196901 36522754 ~ 36528580 (+)
G2132611 LOC100380659 other upstream 352349 36365556 ~ 36369967 (+)
G2132519 LOC100380659 other upstream 357322 36339094 ~ 36364994 (+)
LOC110508289 LOC106597230 other upstream 747184 35973386 ~ 35975132 (+)
G2132291 NA other upstream 1022081 35699846 ~ 35700235 (+)
G2133551 NA other downstream 316063 37038653 ~ 37038924 (+)
G2134356 NA other downstream 1246513 37969103 ~ 37969465 (+)
G2134434 NA other downstream 1400806 38123396 ~ 38143819 (+)
LOC110508247 LOC106596897 other downstream 1803085 38292386 ~ 38526926 (+)
LOC118944840 LOC106596771 other downstream 2066952 38789495 ~ 39333323 (+)

Expression


Co-expression Network