G2134649


Basic Information

Item Value
gene id G2134649
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 38166161 ~ 38166435 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2440849
gctcccgcctgtccagtgctgccggagccttcctcctctccagcgctgccggagtctcccgcctgtccagcgctgccagagccttcctcctctccagcgctgccggagtcttcaaatcaaatcaaatcaaatttatttgtcacatacacatggttagcagatgttaatgcgagtgtagcgaaatgcttgtgcttctagttccgacaatgcagtaataaccaacaagtaatctaactaacaattccaaaactactgtcttgtacacagtgtgaggg

Function

NR:

description
LOW QUALITY PROTEIN: transcription and mRNA export factor ENY2-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2440849 True 275 lncRNA 0.50 1 38166161 38166435

Neighbor

gene id symbol gene type direction distance location
LOC110509125 LOC106596905 coding upstream 471530 37674818 ~ 37694631 (+)
LOC110509126 LOC106596905 coding upstream 515176 37625498 ~ 37650985 (+)
LOC110509119 rala coding upstream 695360 37447739 ~ 37470801 (+)
c28h7orf25 cssa03h7orf25 coding upstream 723263 37438032 ~ 37442898 (+)
LOC118944833 NA coding upstream 1183901 36977174 ~ 36982260 (+)
LOC110509128 LOC100136478 coding downstream 44841 38211276 ~ 38229238 (+)
LOC110508247 LOC106596897 coding downstream 125951 38292386 ~ 38526926 (+)
LOC110509131 LOC106596891 coding downstream 368122 38534557 ~ 38549486 (+)
LOC118944835 NA coding downstream 582581 38749016 ~ 38756005 (+)
LOC118944840 LOC106596771 coding downstream 623060 38789495 ~ 39333323 (+)
G2134646 NA non-coding upstream 1289 38164661 ~ 38164872 (+)
G2134451 NA non-coding upstream 17074 38148865 ~ 38149087 (+)
G2134450 NA non-coding upstream 17891 38147971 ~ 38148270 (+)
G2134445 NA non-coding upstream 21737 38144201 ~ 38144424 (+)
G2134334 NA non-coding upstream 236678 37928436 ~ 37929483 (+)
G2134662 NA non-coding downstream 16729 38183164 ~ 38185179 (+)
G2134678 NA non-coding downstream 56328 38222763 ~ 38223541 (+)
G2134696 NA non-coding downstream 92221 38258656 ~ 38258863 (+)
G2134698 NA non-coding downstream 96844 38263279 ~ 38263568 (+)
G2134702 NA non-coding downstream 102230 38268665 ~ 38269422 (+)
G2134434 NA other upstream 22342 38123396 ~ 38143819 (+)
G2134356 NA other upstream 196696 37969103 ~ 37969465 (+)
G2133551 NA other upstream 1127237 37038653 ~ 37038924 (+)
LOC110509112 LOC106597339 other upstream 1640746 36522754 ~ 36528580 (+)
G2132611 LOC100380659 other upstream 1796194 36365556 ~ 36369967 (+)
G2135186 NA other downstream 681045 38847480 ~ 38848317 (+)
G2135433 NA other downstream 1260412 39426847 ~ 39428093 (+)
G2135679 NA other downstream 1946149 40112584 ~ 40115950 (+)

Expression


Co-expression Network