G2136118



Basic Information


Item Value
gene id G2136118
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 39726011 ~ 39727848 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2442808
ggggtgatggcttttgggaggcagggtgatggcggtgatggcttttgaaggcagggtgatggcagtgatggcttttggaaggcagggtgatggcttttggaaggcagggtgatggcggtgatggcttttggaaggcagggtgatggcagtgatggcttttggaaggcagggtgatggcagtgatggcttttggaaggcagggtgatggcagtgatggcttttggaaggcagggtgatggcggtgatggcttttggaaagcaggtcagggtggtgatggcttttgggaggcaggtcagggcggtgatggcttttgggaggcagggtgatggcttttgggaggcaggtcagggtggtgatggcttttggaaggcggggtgatggcttttgggatgcaggtcaggggggtgatggcttttggaaggcagggtgatggcttttggaaggcaggtcaggggggtgatggcttttggatggcaggtcagggtggtgatggcttttggaaggcagggtg
>TU2442809
tgatggcgtttgggaggcagggtgatggcggtgatggcttttgaaggcagggtgatggcagtgatggcttttggaaggcagggtgatggcttttggaaggcagggtgatggcggtgatggcttttggaaggcagggtgatggcagtgatggcttttggaaggcagggtgatggcagtgatggcttttggaaggcagggtgatggcagtgatggcttttggaaggcagggtgatggcggtgatggcttttggaaagcaggtcagggtggtgatggcttttgggaggcaggtcagggcggtgatggcttttgggaggcagggtgatggcttttgggaggcaggtcagggtggtgatggcttttggaaggcggggtgatggcttttgggatgcaggtcaggggggtgatggcttttggaaggcagggtgatggcttttggaaggcaggtcaggggggtgatggcttttggatggcaggtcagggtggtgatggcttttggaaggcagggtg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2442808 False 512 lncRNA 0.58 2 39726011 39726656
TU2442809 True 508 lncRNA 0.57 3 39726011 39727848
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118944836 ralbp1 coding downstream 8327 39714554 ~ 39717684 (-)
rab31 rab31 coding downstream 75645 39633741 ~ 39650366 (-)
LOC110509137 LOC105025287 coding downstream 104919 39577116 ~ 39621092 (-)
LOC118944811 NA coding downstream 143460 39579694 ~ 39582551 (-)
LOC118944870 LOC106596806 coding downstream 1023403 38685275 ~ 38702608 (-)
LOC110509145 ankrd12 coding upstream 50704 39778552 ~ 39829207 (-)
ndufv2 ndufv2 coding upstream 115463 39843311 ~ 39869936 (-)
LOC110508256 LOC106596607 coding upstream 245519 39973367 ~ 40103148 (-)
LOC110509140 LOC106596615 coding upstream 387553 40115401 ~ 40127201 (-)
LOC110508253 LOC106591876 coding upstream 440563 40168411 ~ 40317511 (-)
G2136103 NA non-coding downstream 12179 39651685 ~ 39713832 (-)
G2136107 NA non-coding downstream 18943 39694223 ~ 39707068 (-)
G2136105 NA non-coding downstream 35981 39667040 ~ 39690030 (-)
G2136122 NA non-coding upstream 31005 39758853 ~ 39921777 (-)
LOC110509148 LOC106596679 non-coding upstream 33081 39719697 ~ 39763225 (-)
G2136140 NA non-coding upstream 69159 39797007 ~ 39797356 (-)
G2136156 NA non-coding upstream 105831 39833679 ~ 39834325 (-)
G2135837 NA other downstream 719961 39005461 ~ 39006050 (-)
G2135034 LOC106596897 other downstream 1199091 38519571 ~ 38526920 (-)
G2134625 NA other downstream 1595604 38128129 ~ 38130407 (-)
LOC110509127 LOC106596915 other downstream 1786168 37766370 ~ 37996222 (-)
LOC110509111 LOC106597319 other downstream 3168558 36526794 ~ 36557532 (-)
G2136189 NA other upstream 215305 39943153 ~ 39945834 (-)
G2136243 NA other upstream 323791 40051639 ~ 40121899 (-)
G2137086 NA other upstream 687455 40415303 ~ 40415540 (-)

Expression


G2136118 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G2136118 Expression in each Bioproject

Bar chart with 13 bars.
G2136118 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network