G2137663



Basic Information


Item Value
gene id G2137663
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 41881958 ~ 41882358 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2444801
ggtgccaacagtctgaccactctgggacctatggtgtcaccagtctgaccactctgggacctgccaccagtctgaccactctgggacctgccaccagtctgaccactctgggacctacggtgccaccagtctgaccactctgggacctacagtgccaccagtctgaccactctgggacctgccaccagtctgacctctctgggacctgccaccagtctgaccactctaggacctgccaccagtctgaccactctgggacctacagtgccaccagtctgaccgctctaggaactatggtgccaccagtctaaccactctgggacctatggtgcctccagtctgaccgctctgggaccggccaccagtctgaccactctgggacctatggtgccaccagtctg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2444801 True 401 lncRNA 0.61 1 41881958 41882358
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110509166 LOC106596257 coding downstream 240792 41630582 ~ 41641166 (-)
znf414 znf414 coding downstream 255118 41587299 ~ 41626840 (-)
si:ch211-106k21.5 LOC106596230 coding downstream 313213 41551990 ~ 41568745 (-)
LOC110509161 rs8 coding downstream 345761 41532971 ~ 41536197 (-)
LOC110508267 LOC106596213 coding upstream 24424 41906782 ~ 42137364 (-)
cfap410 cunh21orf2 coding upstream 478389 42360747 ~ 42368140 (-)
LOC118944818 NA coding upstream 487507 42369865 ~ 42370480 (-)
LOC110509173 NA coding upstream 518157 42400515 ~ 42410701 (-)
LOC110509174 them6 coding upstream 589533 42471891 ~ 42493837 (-)
G2137662 NA non-coding downstream 25469 41855452 ~ 41856489 (-)
G2137660 LOC106596213 non-coding downstream 29523 41844082 ~ 41852435 (-)
G2137652 LOC106596213 non-coding downstream 47424 41824342 ~ 41834534 (-)
G2137639 NA non-coding downstream 125741 41755994 ~ 41756217 (-)
G2137636 NA non-coding downstream 132890 41748668 ~ 41749068 (-)
G2137667 NA non-coding upstream 14485 41896843 ~ 41897346 (-)
G2137671 NA non-coding upstream 16011 41898369 ~ 41901209 (-)
G2137677 NA non-coding upstream 22832 41905190 ~ 41906407 (-)
G2137729 NA non-coding upstream 30408 41912766 ~ 41916223 (-)
G2137741 NA non-coding upstream 66142 41948500 ~ 41949168 (-)
G2137648 LOC106596196 other downstream 67757 41810795 ~ 41814201 (-)
G2137555 NA other downstream 145569 41731714 ~ 41736389 (-)
G2137419 NA other downstream 620687 41260800 ~ 41261271 (-)
G2137111 NA other downstream 1406257 40472088 ~ 40475701 (-)
G2137814 LOC106597294 other upstream 338564 42220922 ~ 42226965 (-)
G2138294 LOC106594920 other upstream 466858 42349216 ~ 42351452 (-)
emilin2a LOC106595984 other upstream 1492389 43343531 ~ 43398034 (-)

Expression


G2137663 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G2137663 Expression in each Bioproject

Bar chart with 8 bars.
G2137663 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network