G2138414



Basic Information


Item Value
gene id G2138414
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 42599681 ~ 42600138 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2445727
ACACGCCTGTTATAGTGTGGACTGGTTAATCTGGGGTCTAACACACGCCTGTTATAGTGTGGACTGGTTAGTCTGGGGTCTAACACACGCCTGTTATAGTGTAGACTGGTTACTCTGGGGTCTAACACACGCCTGTTATAGTGTGGACTGGTTAGTCTGGTTTCAGAGAGGTCAGCCTATTATAGGCAGACCCCAGAGTAACCAGTCCACACTATAACAGGCGCGTGTTAGACCCCAGACTAACCAGTCTACACTATAACAGGCGTGTGTTAGACCCCAGACTAACCATGGTTACCATGGAGACAAGGAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2445727 True 310 lncRNA 0.49 3 42599681 42600138

Neighbor


gene id symbol gene type direction distance location
them6 them6 coding downstream 91476 42498283 ~ 42508205 (-)
LOC110509174 them6 coding downstream 105844 42471891 ~ 42493837 (-)
LOC110509173 NA coding downstream 188980 42400515 ~ 42410701 (-)
LOC118944818 NA coding downstream 229201 42369865 ~ 42370480 (-)
cfap410 cunh21orf2 coding downstream 231541 42360747 ~ 42368140 (-)
LOC110508271 NA coding upstream 30007 42625607 ~ 42703120 (-)
LOC110509177 LOC106597278 coding upstream 133505 42733643 ~ 42772837 (-)
LOC110508296 pde1c coding upstream 277358 42877496 ~ 42959408 (-)
LOC110509179 LOC105010334 coding upstream 373217 42973355 ~ 42987359 (-)
LOC118944838 LOC106596014 coding upstream 441084 43041222 ~ 43077460 (-)
G2138386 NA non-coding downstream 76897 42522314 ~ 42522784 (-)
G2138367 NA non-coding downstream 122038 42476443 ~ 42477643 (-)
G2138366 NA non-coding downstream 123822 42475470 ~ 42475859 (-)
G2138358 NA non-coding downstream 138153 42460429 ~ 42461528 (-)
G2138348 NA non-coding downstream 168037 42431289 ~ 42431644 (-)
G2138420 NA non-coding upstream 10919 42611057 ~ 42615032 (-)
G2138424 NA non-coding upstream 23152 42623290 ~ 42625470 (-)
G2138439 NA non-coding upstream 44380 42644518 ~ 42645096 (-)
G2138441 NA non-coding upstream 48284 42648422 ~ 42648758 (-)
G2138294 LOC106594920 other downstream 248229 42349216 ~ 42351452 (-)
G2137814 LOC106597294 other downstream 372716 42220922 ~ 42226965 (-)
G2137648 LOC106596196 other downstream 785480 41810795 ~ 41814201 (-)
G2137555 NA other downstream 863292 41731714 ~ 41736389 (-)
LOC110509166 LOC106596257 other downstream 968298 41630582 ~ 41641166 (-)
emilin2a LOC106595984 other upstream 774609 43343531 ~ 43398034 (-)

Expression


G2138414 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G2138414 Expression in each Bioproject

Bar chart with 4 bars.
G2138414 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network